good

Q: Write the name and the label of this picture asap thanks

A: The central axis of the skeletal system is the vertebral column which is also known as the spinal…

Q: summary paragraph describing lysozyme and what it does

A: Lysozyme is a important enzyme perform verious important role in body. Lysosome helps in the…

Q: I need help

A: A type of diffusion in which molecules, water, and ions move from a higher concentration region to a…

Q: I need answer very fast

A: We can say that Blood is a fluid connective tissue that comprises red blood cells (RBC), white blood…

Q: 2. Hemoglobin mutants (Answers to this question won't be posted – discussed in Discussion.) A. For a…

A: In T-R equilibrium for a mutant, a shift towards the R state indicates an increase in oxygen…

Q: of vifomin c Woite atleast thrpe Yole in oUr body.

A: Vitamin C is also known as ascorbic acid and its active form is ascorbic acid.

Q: Read and record the volume of liquid. Meniscus 100 ml Read 90 volume at bottom of meniscus.…

A: In the given figure, we are shown liquid sample which is filled in graduated cylinder. We have to…

Q: Bernard Katz won a Nobel prize for studying SNARE proteins. O True O False

A: SNARE proteins mediate vesicle fusion, a process that's essential for neurotransmission. While both…

Q: Which of the following is/are true about the signal recognition particle (SRP). Choose all that…

A: SRP is defined as the signal Receptor Protein that is a ribonucleoprotein particle and helps in…

Q: The adrenal medulla is important to the sympathetic branch of the autonomic nervous system because…

A: the adrenal medulla is the grey core of the adrenal gland. it is made up of cells called chromaffin…

Q: The kidney is a target of several complicated pathways, but the effects can be summarized as the…

A: Kidney are bean shaped organ located on either side of back of abdomen. Humans have two kidneys, its…

Q: POISON CONTROL CENTER (PCC) " & MAIN ASPECTS OF POISON CONTROL CENTER.

A: Poison Control Centers are specialized facilities which is generally provides the urgent facilities…

Q: Please help me illustrate the structure of ABH antigen substances

A: The ABO blood grouping system was discovered by Karl Landsteiner. A, B, AB, and O are the main blood…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Ahmad was stung by a honey bee, after some time many other honey bees gathered around him for…

A: Bees are a vital source of most of the dairy products that we use today. From the food, we eat to…

Q: U meet a person who had a chemical liquid in his eyes two minutes ago what to do .A Wash his eyes…

A: Our eyes are very important and delicate organs. It is important to be careful while we are handling…

Q: Songbirds sing using a type of muscle fiber called super fast-twitch muscles. These super…

A: Muscle contraction and relaxation are regulated by the levels of calcium ions in the sarcoplasm…

Q: 5. What is Bacteriophage typing?

A: Bacteriophages are viruses that target and destroy bacteria. Viruses can be broadly divided into two…

Q: ASTIGMATISM usually causes HEADACHE .A true .B false

A: The eye is the photosynthesitive organ in our body that is responsible for both color vision and dim…

Q: help me with these  three parts please.thanks!   if u use AI tooks, which is very easy to…

A: Anatomical region vs. Functional description:Anatomical regions refer to specific physical areas of…

Q: Which procedure is represented in the diagram?

A: The movement of water across a membrane is called as osmosis. Diffusion is the movement of molecules…

Q: Instead of Thymine, RNA uses

A: Nucleic acids are made up of 4 nucleotide molecules as there are four nitrogenous bases.DNA or…

Q: Poison control center and its aspects.    Please attach some diagram, pictures or Figures…

A: A poison control center (PCC) is a department in a medical facility that assists in any hazardous…

Q: Choose all that apply. A nerve impulse is an electrical charge traveling along the neuron. Which…

A: Explanation: The membrane potential is the basis for the conduction of nerve impulses along the cell…

Q: The size of the pupil is controlled by the O lens

A: The eye is the sensory organ that allows us to see. The eyes achieve vision with the help of visual…

Q: I need answer asap thanks for handling this question

A: We can say that The skin color of humans is affected by many different substances. There are three…

Q: A в с E D F

A: Understanding anatomical terminology is crucial for accurately describing the locations and…

Q: memorizing parts of the bran, such as the thalumaus ect.

A: Introduction The brain is an organ that governs all body processes, interprets information from the…

Q: a neural impulse; a brief electrical charge that travels down the axon the junction between the end…

A: Here are the correct matches to all the definitions listed.

Q: Can you please answer this question and say the correct letter

A: This is the second phase of action potential, where the Ca2+ channels open and allowing the movement…

Q: Pls help if u can, sorry for the trouble Relate these terms in a single sentence: cells, organs,…

A: Introduction The fundamental and basic units of all living things are cells. There are many billions…

Q: You have floaters, don' worry, it is-20 usually benign .A true .B false .c

A: Eye floaters are dabs or bits in an individual's vision that appear to drift away when the…

Q: 1. Is there an alternative to pricking your fingers for blood glucose tests? 2. How accurate are…

A: 1. Blood glucose tests: [alternative]                     Earlier traditional blood glucose meter…

Q: We got you something. 0₂ I love it! I'm going to share it with EVERYONE! Other Explain what is going…

A: Introduction Gas exchange is the process by which oxygen (O2) and carbon dioxide (CO2) are exchanged…

Q: how the drug affected brain cells at the cellular or molecular level

A:

Q: Occluding junction is serves as a channels for communication between adjacent cells. O False O True

A: Cell junctions are structures created by a few different transmembrane proteins, whose principal…

Q: Question 4 Smooth muscle multiple nuclei True False

A: The muscles which are non-striated, involuntary in nature and found in the visceral organs are known…

Q: 32 bit laptop comp.. E- H-

A: Glands in the body are basically of two types :-  A ) Exocrine gland B ) Endocrine gland Exocrine…

Q: The type your answer. is a grooved region of the that allows for communication bewteen the axon…

A: Axons, also known as nerve fiber refers to long slender projection of the neuron, which brings about…

Q: The distinctness of a subspecies: O is not biological. O O can be measured by clear genetic…

A: The distinctness of subspecies can be measured by clear genetic differences. Therefore, "can be…

Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 10° to 10-7…

A:

Q: I am so confused with the positive feedback mechanism. could you help me understand it with the help…

A: Introduction: The internal body environment should be kept in balance with respect to the external…

Q: Please answer fast  And all

A: SCFs typically target CDK inhibitor SCF complexes physically link substrate proteins to the E2…

Q: What would allow two cells from the same individual to respond differently to an environmental…

A: Cell communication It refers to the way a cell receives, understands, and sends signals to its…

Q: Given that CDKS are "kinases", how do they activate or inactivate other proteins? Why are cyclins…

A: Period between two mitotic division is called as the cell cycle. Cell cycle is the event taking…