Gloc Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia Lamproscapha Mar. margaritilere M. monodonta Lamell. corrianus L generosus Parreysia olivacea P. tavoyensis Coelatura Oxynaia Scabies Radiatula Unio Lasmigona Pragnadon
Q: What type of chlorophyll used by cyanobacteria when shaded Chlorophyll a Chlorophyll b…
A: Cyanobacteria form the most important oxygen producing bacteria of the plane and are prokaryotes.…
Q: A genetic mutation leading to under expression of a cell membrane receptor would have the most…
A: Introduction :- Genetic mutation refers to a permanent change in the DNA sequence that makes up a…
Q: GM foods are sometimes derided as “Frankenfoods.” Is this a fair way to characterize them? Do you…
A: GM (Genetically Modified) foods are crops that have had specific genes in their DNA introduced,…
Q: Calculate Simpson's Diversity Index D. Show your solutions. species Number (n) Gammarus pulex (water…
A: We are given number of individulas of different species. We have to calculate simpson's diversity…
Q: Using your knowledge of lipid structure and properties and any other scientifically reliable online…
A: Introduction :- HDL, or high-density lipoprotein, is a type of cholesterol that is often referred to…
Q: ere may
A: Introduction: DNA (Deoxyribonucleic acid): DNA is a double-stranded, helical molecule that…
Q: Describe how changes in the ladybugs'environment may influence their survival and/or reproduction.
A: Ladybugs belong to the phylum arthropods and are natural killers for many herbivorous insects. They…
Q: Would the biologist agree or disagree with the following statements? a) Since there was no…
A: Introduction :- Habitat refers to the place or type of environment where an organism lives and…
Q: 30. Which of the following statements are correct regarding a nucleosome? a.) contains an octamer…
A: Introduction A nucleosome is the basic unit of DNA packaging in eukaryotic cells. It is composed of…
Q: Define the term 'oedema' and in your response show your understanding how liver disease can…
A: Oedema is defined as it is abnormal accumulation of watery fluid in the serous cavity or…
Q: What is the relationship between the structures (tissues and cells) and their location with respect…
A: In plants different types of tissues are found at different locations. These plants perform…
Q: What is the genetic mechanism behind BWS and RSS in Parental imprinting?
A: A subset of genes are expressed differently depending on the parent, a phenomenon known as genomic…
Q: Calculate the CFU per m 1 -0.000.000 SAMPLE 1mi Conf TNTC imi TNTC 400 35 Im
A: CFU/ml is determined by multiplying the total number of colonies by the dilution factor and dividing…
Q: 20 known diseases that are transmitted through the food we eat. True false?
A: INTRODUCTION A disease is a medical condition, typically caused by an infectious agent, which…
Q: 15. Where are excess hydrogen ions removed from the body? a. in the distal tubules after a reaction…
A: Introduction : The nephron is the functional unit of the kidney. Nephrons are basic filtering units…
Q: More people die from injuries each year than malaria, tuberculous and HIV combined. True False?
A: Injuries are a major cause of death and disability around the world, but many people don’t realize…
Q: Functions of the cardiovascular system and respiratory system
A: INTRODUCTION Functions of respiratory and cardiovascular system is given below.
Q: Why is the skin cancer rate in Australia so high? Claim 2: There is something different about…
A: Skin cancer is a common type of cancer that affects a large number of people in many countries. Skin…
Q: Having five fingers on each hand is a recessive trait, yet most people in the world are born with…
A: Dominant and recessive traits are terms used in genetics to describe how a trait expresses itself…
Q: Why and how do you think the phenomenon of periodicity in filiarial worms evolved?
A: Microfilaria is the early Juvenile stage in many of the worms belonging to the group nematodes.…
Q: Explain the different parts to the mitochondria
A: Introduction : Mitochondria is a double-membrane-bound cell organelle. It plays an important role…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Q: Assuming (i) that the two chromosomes in every homologous pair carry different alleles of some…
A: Introduction :- A chromosome is a structure in cells that contains genetic material in the form of…
Q: 35. Which of the following occur during processing of pre-mRNA? a.) removal of exons b.) removal of…
A: The process of transcription takes place in nucleus,in which mRNA is synthesised from the…
Q: In a certain species of plants, violet flower color (V) is dominant over white flower color (v). If…
A: This question is about the concept of dominance and recessiveness in genetics, specifically in the…
Q: A child weighs 11 kilograms. The health care provider orders a drug as follows: 0.2 mg/kg…
A: Drugs can be administered orally, intravenously, intramuscularly, subcutaneously route, rectal,…
Q: Assisted protein folding is facilitated by a specific class of proteins called _______.
A: INTRODUCTION Proteins are essential molecules for all living organisms, made up of amino acid…
Q: rial dilutions: two 10-fold dilutions, followed by a 5-fold dilution, followed by 2-fold dilution.…
A: given that there are 35 cells but volume is not mentioned so let's assume 35 cells are present in 1…
Q: 1.1. Every day, millions of neurons of brain cells die that are why our body tends to reproduce them…
A: Introduction The following are some of the defining characteristics of living organisms: Cellular…
Q: If a population is in Hardy-Weinberg Equilibrium, where the dominant allele frequency is 0.2. Which…
A: If the dominant allele frequency in a population is 0.2 and there is Hardy-Weinberg equilibrium. The…
Q: Imagine this scenario: In E.coli the Operon X encodes for Proteins Y, X and Z. Proteins Y, X and Z…
A: Introduction The lac operon is a group of genes in bacteria that are regulated as a unit and are…
Q: ucation if a learner is a patient, what are the ramifications of not engaging with the
A: Introduction: Class sizes are growing and technology is transforming education at all levels,…
Q: Drag each description to the appropriate column. (Each box is used once.) In the Bb offspring from a…
A: Law of independent assortment: This law states that the alleles of different genes are distributed…
Q: A cell was isolated from a crime scene. Observations revelated the cell has ribosomes, its DNA is…
A: Prokaryotes and eukaryotes are the two main types of cells found in living organisms. Prokaryotic…
Q: Fill in the blank The ______ acts to position RNA polymerase II for transcription initiation. The…
A: Introduction :- Histones are proteins that play a crucial role in packaging and organizing the DNA…
Q: ent will h Use DIMENSIONAL ANALYSIS for 11-20 11. Your patient receives Crystodigin 0.1 mg po daily…
A: So, this is the question related to pharmacology. We need to calculate dose to be taken by the…
Q: What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a…
A: The regulatory region of the eukaryotic transcription unit is characterized by multiple types of…
Q: Transcribing and translating transcribe and translate the following DNA molecules…
A: DNA (Deoxyribonucleic acid) acts as the hereditary or genetic material of almost all biological…
Q: do not know the answer for 3 and 4 about the punnet s
A: Introduction: Genetics is the branch of biology that studies heredity and the variation of inherited…
Q: How similar are the genes of different species? Does this reflect how different or similar the…
A: The relationship between the similarity of genes in different species and the similarity of their…
Q: Describe the results depicted in Fg1. and us it to provide an explanation for these observations…
A: Phenylketonuria (PKU) is an inherited disorder, meaning that it can be passed from parents to…
Q: at ed $ 7) a 8) Describe one example of diffusion in the human body. In your description be sure to:…
A: Insulin/Glucagon Diffusion- • We have modeled the rate of insulin and glucagon secretion at the…
Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…
A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…
Q: What are the major points and why are they important? Based on attached photo
A: The Covid pandemic has resulted in decrease of sexual frequency and satisfaction of relationships.…
Q: Golden Line: Rationale: (Tell me why the authors put this diagram here. What do you think is its…
A: The fluid mosaic model is a widely accepted theory that describes the structure and function of the…
Q: Give the result(s) of the experiment in "MicroRNAs Control De Novo DNA Methylation Through…
A: INTRODUCTION MicroRNAs (miRNAs) are a class of small, single-stranded non-coding RNAs that regulate…
Q: The human genes that convey a susceptibility to hereditary nonpolyposis colorectal cancer are genes…
A: A group of systems which recognise and repair damage to DNA molecules make up DNA repair. There are…
Q: draw a punnett square for both parents are dominate tall, name the 4 possible offspring.
A: Punnett square is a square diagram which is used to find the genotypes of a cross. It is used to…
Q: What are 4 features (structural, functional, etc) that Watson and Crick discovered concerning B-DNA?
A: The discovery of the structure of B-DNA by James Watson and Francis Crick in 1953 was a major…
Q: Which does not describe monocots? O A. Parallel veins B. Fibrous roots
A: Angiosperms are of two types - monocotyledons and dicotyledons. There are various kinds of monocot…
Step by step
Solved in 3 steps
- having scale leaves with liguleclubmossmarsileasalviniaselaginellaASE entopy 10.)A Protin mole cule, in its folded Nalie s tade corfomation randem Coil, dvith many fossible conomatias , hus One favoured whenit is denatue d d buomn rabion. a) what must h the Alan f As for e Sdlenatired 2 ta) the Change Native Condriadion of AŚ to the tre eveigy thang b t Or -?. bet or-? what juquirumnt dloa Starle Ah H this impose Dn frotrina are to be stnuctures? it bided nativeH True False Glochidia morphology (shape) Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia Lamproscapha Mar, margaritifera M. monodonta Lamell. corrianus L. generosus Parreysia olivacea P. tavoyensis Coelatura Oxynaia Scabies Radiatula Unio Lasmigona Pyganodon Quadrula Amblema Lampsillis Truncilla Potamilus Ensidens Contra. contradens Contradens sp. Trapezoideus Gonided Potomida Lamprotula Pronodularia 28 S-shaped hooked Unhooked Lasidia 51 B DEF Hooked w/ spines Axe-head shaped Asymmetrical Hyriidae 0000 Lasidium-bearing Mussels Margaritiferidae DO 0000 Parreysiinae 0000 00000 00000 ▬▬▬▬ ▬▬▬ 777000 HUDUDD P. vondembushianus D007 P. cambodjensis 00000 Unioninae DOO 00000 00000 Ambleminae 000 Rectidentinae Pilsbryoconcha Pseudodon cumingi Gonideinae P.mouhtil Pinoscularis Given the above phylogeny, is the following statement true or false? Hyrriidae mussels are less evolved than Ambleminae mussels.
- True False Glochidia morphology (shape) Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia Lamproscapha Mar, margaritifera M. monodonta Lamell. corrianus L. generosus Parreysia olivacea P. tavoyensis Coelatura Oxynaia Scables Radiatula Unio Lasmigona Pyganodon Quadrula Amblema Lampsillis Truncilla Potamilus Gonidea Potomida Lamprotula Pronodularia Pilsbryoconcha Pseudodon cumingii P. mouhtil Pinoscularis S-shaped hooked Lasidia P. vondembushianus P. cambodjensis $RESTES 000 DOO Ensidens 0000 Contra. contradens 0000 Contradens sp. Trapezoideus 0000 000 000 00000 00000 FERIE 27 המקום Unhooked Hooked w/ spines Axe-head shaped Asymmetrical DOOD Hyriidae Lasidium-bearing Mussels Margaritiferidae Parreysiinae Unioninae Ambleminae Rectidentinae Gonideinae Given the above phylogeny, is the following statement true or false? The common ancestor of Rectidentinae mussels most likely had Unhooked glochidia.Glochidia morphology (shape) True False Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia Lamproscapha Mar. margaritifera M. monodonta Lamell. corrianus L generosus Parreysia olivacea P. tavoyensis Coelatura Oxynaia Scabies Radiatula Unio Lasmigona Pyganodon Quadrula Amblema Lampsillis Truncilla Potamilus 5-shaped hooked Lasidia 488 79545 DODHyriidae 0000) Lasidium-bearing DOOD ‒‒‒‒‒ Hooked w/ spines Unhooked Axe-head shaped Asymmetrical Mussels S Margaritiferidae 00 ☐☐☐☐☐☐ CO Parreysiinae 00000 00000 000 Ambleminae 00 777107 12 12 12 12 Unioninae Ensidens Contra. contradens Rectidentinae Contradens sp. Trapezoideus 00000 Gonidea tomida ☐☐☐☐ mprotula Pronodularia ☐☐☐☐ Pilsbryoconcha Pseudodon cumingii 00000 P. mouhtil P. inoscularis 7711 P. vondembushianus 000000 P.cambodjensis DOOOOL Gonideinae Given the above phylogeny, is the following statement true or false? Mytilus is the common ancestor of all of the mussels in this phylogeny.True False Mytilus Mercenaria Neotrigonia Velesunio Glochidia morphology (shape) Hyridella Castalia Triplodon Etheria Chambardia Lamproscapha Mar, margaritifera M. monodonta Lamell. corrianus generosus Parreysia olivacea P. tavoyensis Coelatura Oxynaio Scabies Radiatula Unio Lasmigona Pyganodon Quadrula Amblema Lampsillis Truncilla Potamilus Ensidens Contra. contradens Contradens sp. Trapezoideus Gonided Potomida Lamprotula Pronodularia P. vondembushianus P. cambodjensis 5-shaped hooked Lasidia PSS VESES JO 000 DO ▬▬▬▬▬ Hooked w/ spines Unhooked Axe-head shaped Asymmetrical ▬▬▬ Pilsbryoconcha Pseudodon cumingii 00000 777777 P. mouhtil Pinoscularis DENITE Hyriidae Lasidium-bearing Mussels Margaritiferidae 00:00 Parreysiinae Unioninae ▬▬▬▬ 00000 Ambleminae ▬▬▬▬ 0000 Rectidentinae Gonideinae Given the above phylogeny, is the following statement true or false? Mussels with asymmetrical glochidium are not monophyletic (do not form a clade).
- True False Mytilus Mercenaria Neotrigonia Velesunio Glochidia morphology (shape) Hyridella Castalia Triplodon Etheria Chambardia Lamproscapha Mar. margaritifera M. monodonta Lamell. corrianus L generosus Parreysia olivacea P. tavoyensis Coelatura Oxynaia Scabies Radiatula Unio Lasmigona Pyganodon Quadrula Amblema Lampsillis Truncilla Potamilus Ensidens Contra, contradens Contradens sp. Trapezoideus Gonided Potomida Lamprotula Pronodularia Pilsbryoconcha Pseudodon cumingii P. mouhtil Pinoscularis Lasidia 5-shaped hooked Unhooked O DO 100000 00000 01 17 DOGOO Parreysiinae 0000 ▬▬ 00000 Hooked w/ spines Axe-head shaped Asymmetrical 277007 7777 Hyriidae Lasidium-bearing Mussels Margaritiferidae 00000 00000 Ambleminae 00000 00000 P. vondembushianus 00 771 P. cambodjensis 00000 Unioninae Rectidentinae Gonideinae Given the above phylogeny, is the following statement true or false? The common ancestor of Parreysiinae mussels definitely had 'Unhooked' glochidia.Match the column | Types of algae Moteh each descrption o the correct type of aigae. o ot most st topars Consuct potosiness ndeep ocean i v o ke 333 el have o fgeta and case i gal boms. Uricaar win tspartsila ol s i ——— Dinoflageliates ———— Brownaigae ———— GrosnaigeeDescription (1-2 paragraph) and taxonomic account of: Gemmule Grantia Euplectella Euspongia
- BOOkmarks People Tab Window Help O Pro/Eu, Kingdom x - apsva.instructure.com/courses/57285/assignments/764473?module_item_id%3D1581469 jefferson lab A Artington Public S.. M KEnrique Oliva Tec.. O Unit 1 Equations,.. 4 1 point What is the function of a paramecia being torpedo-shaped and covered in cilia? stretch and contract to move travel easily through blood vessels send messages to and from the brain swims easily to find a food source 4 points Read each statement, then select whether it applies to Prokaryotes, Eukaryotes, or Appeared first, approximately 3.5 billion years ago Has a nucleus Has ribosomes Simple. Does not contain any membrane-bound organelles. linadem is onFme Period Asexual and Sexual Reproduction Notes UnY 6 Asemud Reprodketion Type of offepring is * Ocors in met plots, becteria, protists, nd low invertebrates One poren Offepring ore identicel to the porents ketion in whicka new orgrios is prodkced from the porent prorent ond the The Foro Advatages and Disedvantages of Asenud Reprotucion Advatoges-Ldentical to paret, so will get oll Disadvartarps-Identical to parent, so will len get bad characteristics and is less able to to the Types of Asenud Reproduction organiom uses cell division to body parts. * Example starfish, salamander -results in a nen plant that is genetically to the parent plant (a clone). . Examples: strawberry plant, vegyerables, and crops. wd strawery runner to -organism that produces a bud that live on its own. . Example hydra9:18 A docs.google.com * Pitted is Spire Ornamentatio Coiled O Shell O * Scaphopoda have Carry bag O Sac O Cyst Siphon O * Fauna is Phytic O Zoic Plants Trees O