Given the following DNA sequences for cytochrome c, answer the question below. Amoeba Cat Shark Dolphin ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTT CAT TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Kangaroo CТAATCCCCCCGTTTAТССТАСТТТСССАTCTACTAAGT Looking at the given DNA sequences for cytochrome c, which two organisms are the most closely related? O shark and dolphin O cat and kangaroo O amoeba and cat O kangaroo and dolphin

Q: The _______________________ causes the lips to close and pucker.

A: Facial muscles are one of the most unique and structurally complex muscles of our body. Majority of…

Q: Abbreviations (8 points) On the line provided, give meanings for the following abbreviations  what…

A: ABCDE: Skin test for tuberculosisbx: Removal of tissue and microscopic examinationDerm: Study of the…

Q: Abbreviations  On the line provided, give meanings for the following abbreviations, thenwrite each…

A: ABCDE: e. Skin test for tuberculosisbx: h. Removal of tissue and microscopic examinationDerm: c.…

Q: Could I have help with questions 1-5 please? I apologize if the picture is semi-blurry.

A: DNA is the nucleic acid present in the cells of eukaryotic cells.

Q: apical The single cell layer of epithelial cells in the intestine are The region polarized faces the…

A: The single cell layer of epithelial cells in the intestines are POLARISED.  The polarity is…

Q: can i have this in more detail please

A: Tinnitus is a common auditory phenomenon characterized by the perception of sound within the absence…

Q: Lise one sign and one symptom noted in the discharge summary?

A: The sign is what the doctor sees as a piece of evidence of a medical condition or disease or…

Q: Why tablet compression is necessary? Please answer at your own easy words.

A: The objective of the question is to understand the importance of tablet compression in the…

Q: DIVIDING WORDS EXERCISE Separate these words into their component parts (prefix, combining form,…

A: Medical terminologies help in easier understanding of the word. It gives the origin, the components,…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: MEDICAL TERMMAIN ENTRY (pronunciation) MEANING (definition) |1. glycemia |2. hypothalamus 3.…

A: Anatomy is a branch of biology that deals with identifying and characterization of living things'…

Q: The patient was said to have possible BPH.Describe this condition

A: Prostate gland  It is a small accessory gland located between bladder and penis.  Common disorder…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: 2. What is the concentration of solute inside the cell? Write this solute concentration inside each…

A: This is a activity question.

Q: can you answer in 5 simple statement please

A: Robert Koch in the 1890s gave 4 postulates to identify whether a specific microorganism is…

Q: 81. Uonsən Match the device with its type. Submitted Answers Prompts Mouse Input device Printer…

A: Your answer to all the subparts is correct. The mouse is an input device. The printer is an output…

Q: Family health accessment

A: Nursing counselling and advise involves certain intervention which helps process focusing on the…

Q: MEDICAL TERM|MAIN ENTRY (pronunciation)|MEANING (definition) 1. astigmatism 2. blepharitis 3.…

A: Astigmatism is a condition of the eye in which the front surface of the eyes (cornea) of the lens or…

Q: How does the drug interfere with the normal function of the neurotransmitter(s)? What effects are…

A: Drugs are usually used as medicines to help pateints to cope with illness like insomnia, depression,…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.