need correct answer please 5. Given the following DNA sequences for cytochrome c, answer the question below.AmoebaCatSharkDolphinATTAGCGACCAGTTTATCCTACAATCCCGTCTACTT CATcat and kangarooTTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGTamoeba and catCTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGTKangaroo CTAATCCCCCCGTTTATCCTAСТТТСССАТСТАСТАAGTCTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGTLooking at the given DNA sequences for cytochrome c, which two organisms are the most closely related?shark and dolphinkangaroo and dolphin

Below are given DNA sequences. These DNA sequences will form a triplet code which would ultimately…

Given the following DNA sequences for cytochrome c, answer the question below. Amoeba Cat Shark Dolphin ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTT CAT TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Kangaroo CТAATCCCCCCGTTTAТССТАСТТТСССАTCTACTAAGT Looking at the given DNA sequences for cytochrome c, which two organisms are the most closely related? O shark and dolphin O cat and kangaroo O amoeba and cat O kangaroo and dolphin

Given the following DNA sequences for cytochrome c, answer the question below. Amoeba Cat Shark Dolphin ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTT CAT TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Kangaroo CТAATCCCCCCGTTTAТССТАСТТТСССАTCTACTAAGT Looking at the given DNA sequences for cytochrome c, which two organisms are the most closely related? O shark and dolphin O cat and kangaroo O amoeba and cat O kangaroo and dolphin

Principles Of Pharmacology Med Assist

6th Edition

ISBN:9781337512442

Author:RICE

Publisher:RICE

Chapter16: Antifungal, Antiviral, And Immunizing Agents

Section: Chapter Questions

Problem 12RQ

See similar textbooks

Similar questions

Prokaryotes reproduce by___________ and maysometimes exchange genetic material through the processof____________ .
How was Brocadia anammoxidan named? What or who was it named after? (Organisms are often named for where they were found, unique morphological or metabolic features, name of the person who discovered it, etc. Attempt both genus and species name. For example, if my organism was Xanthomonas oryzae, I would Google “Xanthomonas word origin.” and “oryzae word origin.” Often a word origin is Greek or Latin, so Google your word followed by “Greek” or “Latin”)
A B a. Name of the organism. b. Name of structure A of the organism. C. Name of structure B of the organism. d. This organism type shown in the figure above is 1N or 2N? -Phylam HePatophyta (liveworts/Marhantia •Phylum: Btgophgta (Massey polytrichum UUR 15 SPICT uasealar Snedless Pants) OphylumiAscAmycota Sac toa/t y Peniaum s 1um AsO (fur e se lumpterophyta (Ferns) ACA PSilotop hyta (hiskfenms) okum e species 151 o phata (aciab Mosses) 6Species Janta CHsYsetais). SPeCies
Tell me three characteristics of mitochondria that support the endosymbiotic theory
Answer the following question briefly but concisely 1. What are the similarities and differences between magnetosomes and the Gloeomargarita inclusions? 2. How does the flagellum of eukaryotic cells vary from that of prokaryotic cells in their functions? 3. What does the endosymbiotic hypothesis entail, and what evidence backs it up? 4. PHAs and glycogen are expected to be produced under what nutritional conditions? 5. What structural and functional differences exist between fimbriae and pili?
Can you summarize the "Model System For Yeast" its benefits, what Saccharomyces cerevisiae do and what kind of yeast it is. Please provide examples, articles, evidence that elaborate this topic. Please explain this as if your presenting the class about this topic.
The most interesting bacterial group according to Dr. Bragg would be: The Deltaproteobacteria The Firmicutes O The Gammaproteobacteria O The Cyanobacteria All of the following are true statements about events that occur in the apicomplexan life cycle EXCEPT: All of these statements are true. O the sporozoite is the motile infective stage often two completely different organisms host different stages of the life cycle the life cycles include both sexual and asexual stages
Arrange the following layers in the correct order from the inside to outside.
THIS IS A MULTIPART QUESTION, PLEASE ANSWER ALL QUESTION Using the image: 5. Identify whether the organism is a green alga, a diatom, a dinoflagellate, Eubacterium, or a Cyanobacterium. Explain the characteristic(s) that led you to that identification. 6. a. What type of microscopy (brightfield, darkfield, or phase contrast) was to obtain the image? Explain how you can tell. b. Name a different type of microscopy would be also appropriate to use to visualize the organism in the image. How would the image change if you used that type of microscopy instead? 7. The image was taken using a microscope that has 10X, 40X, and 100X objectives. What is a possible magnification for the ocular lens on this microscope? Explain your response or show calculations.
From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to discover what the genus and species is and read the description of the first organism that is listed. mitochondrion chloroplast ribosome nucleus
Visit: https://www.youtube.com/watch?v=7pR7TNzJ_pA&feature=youtu.be Examine an amoeba. Note its locomotion, termed amoeboid movement, which is the slow extension of the cytoplasm, the associated cytoplasmic streaming, and the apparent retraction How do you think amoeba eat? What do you think amoeba eat?
2. Write PRESENT if the organelle in column 1 can be found in prokaryotes (column 2) and eukaryotes(column 3), otherwise write ABSENT. ORGANELLE PROKARYOTE EUKARYOTE Nucleus Cell membrane/plasma membrane Cytoplasm Flagella Mitochondria Endoplasmic reticulum Ribosome Vacuole Chloroplasts