get_longest_word: takes in a sentence as a string argument (string with words separated by whitespaces and no punctuation) and returns the longest word in the sentence. If there are two words of equal longest length, it returns the word that occurs first. o Example: get_longest_word("There are some incredibly long words here") should return 'incredibly'.

get_longest_word: takes in a sentence as a string argument (string with words separated by whitespaces and no punctuation) and returns the longest word in the sentence. If there are two words of equal longest length, it returns the word that occurs first. o Example: get_longest_word("There are some incredibly long words here") should return 'incredibly'.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

USE PYTHON Source: en.wikipedia.org/wiki/Camel_case In some languages, it’s common to use camel caseLinks to an external site. (otherwise known as “mixed case”) for variables’ names when those names comprise multiple words, whereby the first letter of the first word is lowercase but the first letter of each subsequent word is uppercase. For instance, whereas a variable for a user’s name might be called name, a variable for a user’s first name might be called firstName, and a variable for a user’s preferred first name (e.g., nickname) might be called preferredFirstName. Python, by contrast, recommendsLinks to an external site. snake caseLinks to an external site., whereby words are instead separated by underscores (_), with all letters in lowercase. For instance, those same variables would be called name, first_name, and preferred_first_name, respectively, in Python. In a file called camel.py, implement a program that prompts the user for the name of a variable in camel case and outputs…
Python program (recursive function) A recursive function is a function defined in terms of itself via self-referential expressions. This means that the function will continue to call itself and repeat its behavior until some condition is met to return a result. Write a python recursive functionprod that takes x as an argument, and returns the result where, result=1*1/2*1/3*….*1/n Include a screenshot that shows a python program that uses the above function and prints the rounded result to three decimal placesafter prompting the user to enter a number, x. Use x=3. N.B: The code should be included please.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
In what ways could an organization's level of work satisfaction influence its level of success or failure?
please code in pythonRead in and return a list of review dates. The function should ask the user to enter some review dates This should be entered in the format mm/dd/yyyy (same as that in the file) where dd is two-digit day, mm is two digit month and yyyy is a four digit year e.g. 01/22/2020 The function should return a list containing the specified review dates. :return: a list of review datesYou can take any review date as sample example
Implement the following function: Code should be written in python.
language: Python Problem: Write a recursive function to add a positive integer b to another number a, add(a, b), where only the unit 1 can be added, For example add(5, 9) will return 14. When creating the function, also create a test case to prove the program works. The pseudocode is: # Base case: if b is 1, you can just return a + 1# General case: otherwise, return the sum of 1 and what is returned by adding a and b - 1
I need help Note: It`s a python Implement the following:1) Define a function oddList() with an arbitrary parameter a.2) This function accepts any number of integer arguments.3) oddList() stores all odd numbers into a list and returns the list.4) Call the function with 1, 2, 3, 4, 5 as arguments.5) Print the result of the function call. Make sure to precisely match the output format below.Write your code in the ANSWER area provided below (must include comments if using code is not covered in the course). Example Output[1, 3, 5]
Instructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.
Writing Functions that Return a Value Summary In this lab, you complete a partially written Python program that includes a function that returns a value. The program is a simple calculator that prompts the user for two numbers and an operator ( +, -, *, or / ). The two numbers and the operator are passed to the function where the appropriate arithmetic operation is performed. The result is then returned to where the arithmetic operation and result are displayed. For example, if the user enters 3, 4, and *, the following is displayed: 3 * 4 = 12 The source code file provided for this lab includes the necessary input and output statements. Comments are included in the file to help you write the remainder of the program. Instructions Write the Python statements as indicated by the comments. Execute the program.
Note: It`s python code Implement the following code:1) Define a function prodTwo which returns the product of two input parameters, x and y.2) Call the prodTwo function with 4 and 5 as arguments.3) Print the result of the function call. Example Output (4 and 5 are arguments)20
C++ A matrix is a rectangular array of numbers that is arranged in a two-dimensional table. Matrices have numerous applications in computer systems. Matrix structures are examined in computer memory, graphics, and cryptography. The Hill cipher, for example, makes use of matrix inversions to encrypt and decrypt data. The intent of this problem is to develop a C++ program that computes and displays the inversion of a 2 x 2 matrix. A matrix is said to have the dimensions m x n if it has m rows and n columns. A square matrix has the same number of rows as columns, and is therefore said to have m x m dimensions. Matrix M shown below is an example of a 2 x 2 matrix. The inverse of a square matrix, M-1, is defined by the equation M(M-1) = I, where I is called the identity matrix. I is a square matrix that is all zeros except for ones along the main diagonal from the upper left corner to the lower right corner. I for a 2 x 2 matrix is: Multiplying a square matrix by its inverse will always…