Fill im the the missing blanks for both sheets.

Q: True or false: The buffy coat is the portion of a bloodsample that is made up of its proteins.

A: The fluid used for the delivery of oxygen and other nutrients to the cell and removal of waste…

Q: Each single strand of DNA has a phosphate-sugar _________________ on the outside.

A: backbone

Q: Which shape (1, 2, or 3) will migrate the fastest/slowest? 1. Supercoiled 2. Linear 3. Nicked

A: Supercoiled DNA is more compact and smaller in size. So it experiences less friction in the gel and…

Q: ccu ccc cca ccg is a generic code

A: The genetic code is a system of triple letter codons that are made up of a combination of the…

Q: Each _________________- chromosome contains (prior to itsreplication) a single molecule of linear,…

A: during nuclear division, the nuclear material which is the chromatids double in number. they…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A:

Q: Identify the structure indicated by the Yellow arrow.

A: The human body is a well built machine in which all the organs coordinate together to make it work.…

Q: The bacterial chromosome is a ring of____________-stranded DNA.

A: DNA is the source of genetic information that flows from generation to generation. DNA molecules are…

Q: The kind of mutation where one nucleotide is exchanged for another different nucleotide, which may…

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is formed of the…

Q: The _____________ strand is made continously.

A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…

Q: 3₁ 2 LAN CA COND Wasicha pocos \4 5

A: The study of the structure and organization of the human body is called human anatomy. It involves…

Q: Long DNA fragments with many pairs have more bulk and move _____________________________ than small…

A: DNA components are negatively charged, so they drag towards the optimistic electrode. Because all…

Q: There are four different type of nucleic acids which may be strung together to make DNA. These four…

A: There are four different biomolecules are present in nature, they are carbohydrates, protein, lipid,…

Q: The gel serves as a ______________ to separate out the DNA fragments

A: Answer : The gel serves as Sieving medium to separate out the DNA fragments.

Q: Provide the name of the following nitrogen-containing heterocyclic base.

A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…

Q: A,

A: Meosis is the type of cell division which resukts in the formation of the gamete.  In humans the…

Q: You have a 2.5 ng/uL DNA stock. What volume will give you 1.15 mg?

A: Conversion tables are important to find out the actual values in the required unit. Similar…