Q: Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biom...
A: Introduction: The given diagram depicts the production of peptide bonds, which are responsible for t...
Q: Which of the following will happen if the concentration of an enzyme increases for a given substrate...
A: Enzyme is a substance that increases the rate of reaction by converting substrate into product in a ...
Q: 1. Modifications of seaweed hydrocolloids changes its chemical properties and functionality. What ar...
A: Seaweed hydrocolloids are thickening or gelling substances and are mostly used in the food industrie...
Q: peroxisome nuclear pore chloroplast nucleus smooth ER nucleolus microfilament ribosome Golgi apparat...
A: INTRODUCTION Cell is a basic functional unit of life system. Cell is mainly a collectio...
Q: 1. What is the significance of the formation of the blastocoel and blastoderm during blastulation? 2...
A: Blastulation It refers to the production of blastula during the early stages of animal embryonic dev...
Q: what is the basic functions of a capsid, protomer, capsomere, and spikes in the viral infection and ...
A: Viruses are entities that is the link between living and non-living. They are active or live when co...
Q: Life on earth has lasted an estimated 3.5 billion years, experiencing different environmental change...
A: The following changes have developed in the humans and will continue to develop: - Increasing Brain...
Q: Control over eukaryotic gene expression drives______ . a. transcription factors c. embryonic develop...
A: In eukaryotes, gene expression is influenced by a wide range of mechanisms such as loss of genes, am...
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. ...
A: Translation is process in which proteins are synthesized.
Q: are my answers correct?? there were blank spaces
A: The DNA consists of 4 nitrogen bases which are Adenine (A), Thymine (T), Guanine (G), and Cytosine (...
Q: What is the difference between an epidemiologist and a microbiologist?
A: Biology is a branch of science which deals with learning of living organisms . Main disciplines of b...
Q: 10. Membrane-bound organelles have been an important component in the evolution of complex, multicel...
A: Eukaryotic cell : These are the cells that are characterized by the presence of a well defined nucle...
Q: nucleoid ribosomes plasma membrane flagella lysosome mitochondria nucleolus prokaryotic only eukaryo...
A: Prokaryotic and eukaryotic cell share few similarities however show so many difference in their stru...
Q: what is ASTO or ASO test? discuss the principle it's important
A: ASTO/ ASO test is Anti- streptolysin O test. Antistreptolysin O is an antibody produced in human bo...
Q: The study by Wakefield et al. that purported to show a link between autism and the MMR vaccine was p...
A: Answer- (d) All of the above
Q: Q1 The Hardy-Weinberg equation calculates the frequencies of different genotypes from the frequency ...
A: Hardy–Weinberg's principle It proposes that in a population, allele and frequencies of genotype will...
Q: malaria
A: Malaria is a life-threatening disease caused by parasites that are transmitted to people through the...
Q: VilI be easy for you to answer. Activity 5: Solving Problem Directions: Solve the given problem belo...
A: Introduction :- There are different types of inheritance patterns for any gene , these are - autosom...
Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...
A: Answer C --118mEq/L
Q: Which pioneers of microbiology had the biggest impact on surgical patient care?
A: Introduction:- Microbiology always helps us to create numerous medical advancements in terms of unde...
Q: What effect do sodium, caffeine, and alcohol have on calcium levels in the body?
A: The human body is made up of everything that makes you, you. Our genetic information determines and ...
Q: In Drosophila melanogaster, a yellow-bodied (dark coloured) male with vestigial (underformed) wings ...
A: Drosophila malenogaster is a fruit fly from family drosophilidae.
Q: Describe the scope of human population growth
A: Population growth is the increased number of humans in the world. Most of the human history shows th...
Q: ENDEMIC SPECIES IN THE PHILIPPINES Eggs with Shells No. Vertebrae Hair Wings Bilateral Symmetry 1 Ph...
A: Phylogenetic tree is a representation in which relationship of taxon with each as well as it's ances...
Q: cancer theoretical framework 1 Definition of concepts 2 Specification of the hypothesis to be i...
A: The theoretical framework of cancer is the structure that can hold or support a theory of cancer res...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A:
Q: h. Thomas Malthus economist who stated that hu- man populations grow faster than our resources i. ar...
A: Natural selection is a type of artificial selection, in this process organism adapt changes to becom...
Q: Name and describe the idea that explains how mitochondria and chloroplasts are thought to have origi...
A: Photosynthesis is the process through which green plants and some organisms use sunshine to convert ...
Q: Fermentation permits the continued extraction of energy from glucose in the absence of oxygen. If gl...
A: Ferment is derived from the Latin word fervent. The verb fervert means "to boil." Louis Pasteur was ...
Q: e strongest force that caause plate movement is
A: Thermal convection is a force which is caused by the heat of the interior of the earth. Hot currents...
Q: 7. Use the image to answer the following questions A student collects some of this bacteria to creat...
A: Answer 1:- Based on the microbiological examination of the slide shown in the question, the petri d...
Q: [Question 27] Helping kin raise offspring is one way individuals can increase their inclusive fitnes...
A: Introduction: Pedigree analysis is the study of a particular trait that is inherited from one genera...
Q: List and explain at least 3 Viral infections of the skin.
A: Skin is the outermost protective layer of our body. It can be caused by different microorganisms, ...
Q: MAJOR differences in the inflammatory processes which have occurred in your uncle's lungs (he worked...
A: Asbestos: it is along with term disease in the lungs where a scar-like structure is formed on the lu...
Q: . A 20-year-old woman collapses at a wild party several hours after taking ecstasy. Which one of the...
A: Ecstacy is a psychoactive drug, meaning consumption of it has an effect on the functions of brain. I...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: Which of the following statements about E. coli is true? Some infections can be fatal to humans. It ...
A: Correct option A i.e some infection can be fatal to humans.
Q: With over 369,000 species of angiosperms alone, why do you think we get most of our nourishment from...
A: Angiosperms are plants that produce flowers and bear their seeds in fruits. They are the largest and...
Q: Photosynthesis can be divided into multiple stages. What are the stages of photosynthesis, and where...
A: Photosynthesis refers to the biochemical process that occurs in the chloroplasts of plants to conver...
Q: One of the autosomal loci controlling eye color in fruit flies has two alleles: one for brown eyes a...
A: The fruit fly's color of the eye is further controlled by the autosomal locus. The given fly compris...
Q: Describe the main functions of the different components of the ATP synthase enzyme in the mitochondr...
A: ATP synthase is enzyme which is responsible for synthesis of ATP molecules.ATP synthase found in mit...
Q: The achoo syndrome (sneezing in response to bright light) and trembling chin (triggered by anxiety) ...
A: Since human cells Carry 2 sets of chromosomes having same set of genes. So these 2 version of genes...
Q: What is label #7? (snail shell looking thing) A. Cochlea B. spiral valve C. Vestibule D. Eustachian ...
A: Ear is one od the sense organ that help us in hearing. There are majorly divided into 3 parts, *out...
Q: Explain some of the ways genes may interact to affect the phenotype and discuss how a single gene ca...
A: ANSWER: Some of the ways by which genes may interact to affect the phenotype are mentioned below: ...
Q: _____ are characteristic of cancer. a. Malignant cells b. Neoplasms c. Tumors
A: Introduction :- Cancer is a disease that occurs when cells divide uncontrollably and spread into nea...
Q: Clumped dispersion patterns.. arise when local resources are depleted. arise due to aggressive inter...
A: As per our company guidelines we are supposed to answer only first question. kindly repost another ...
Q: eta-lactam, aminoglycosides, polyenes, and quinolone antimicrobial agents on bacterial cells.
A: Antibiotics are antibacterial drugs. Antibiotic drugs are commonly used in the treatment and prevent...
Q: In plants, the transition from water to land most likely happened once twice: ones in the moss linea...
A: The difficulties that the primary land plants needed to defeat going limp in land from gravity, the ...
Q: back ground study of ampalaya
A: Introduction: Ampalaya is also known as Momordica charantia found in the tropical regions of the wor...
Q: You are Jeremy’s Biology professor, and he ask you about taking steps to “bulk up”. What would your ...
A: Being a doctor and taking this question as in general category. One should do the followings things ...
Explain the Baroreceptor Reflex and how it regulates BP & HR. What are the receptors and neural pathways involved?
Step by step
Solved in 2 steps
- List the effects of sympathoadrenal stimulation on different effector organs. In each case, indicate whether the effect is due to alpha- or beta-receptor stimulation.List the four major features that define the interactions betweenreceptors and their ligands?Describe the importance of Ca++ and the difference between the sodium channels in the specialized endings and the voltage gated sodium channels in the sensory neuron.
- Explain how inhibition can be produced by (a) muscarinic ACh receptors in the heart; and (b) GABAreceptors in neurons of the CNS.The Baroreceptor reflex illustrates very well the principles and elements of a negative feedback loop.1) What is the typical circumstance in which the baroreceptor reflex is stimulated? What is the stimulus for the reflex and the response?2a) Using the terms for a homeostatic negative feedback loop or a reflex, describe both the function AND anatomical elements serving that function for each of the following as it applies to the baroreceptor reflex known as: an effector. 2b) applied to the baroreceptor reflex known as: the integration center?Describe how Acetylcholine (ACh) is synthesized stored, released, and binds to ionotropic and metabotropic receptors. How is ACh related to Alzheimer’s disease (AD) and how do the ACh-relevant anti-AD drugs work and describe one non-ACh based theory of AD development and outline how a related treatment works
- Before LTP: In the normal state, what is the effect of glutamate at the AMPA receptors? At the NMDA receptors?You have learned that Shh is in part responsible for attracting commissural axons to the floor plate. What about other classical morphogen signals? Can BMPs from the dorsal neural tube affect dorsoventral pathfinding, or can Wnts expressed in an anteriorto-posterior gradient in the neural tube influence longitudinal axon guidance?Explain in detail Muscarinic receptors in regards to the hisamine agonist. How do they cause smooth muscle contraction. Provide mechanism
- What are the affinities of acetylcholine and nicotine for the nAChR? Are they nM? uM? How does the typical concentration of nicotine in the blood and/or brain compare to its affinity?%3D List the two substances in the body which naturally stimulate opioid receptors. %3D DFocusDiscuss the concept of termination of neurotransmitter action by comparing the mechanisms by which acetylcholine and nitric oxide's actions are terminated. (a) Name the three primary mediators of purinergic receptors. (b) Which one of these mediators is sometimes used to treat supraventricular tachycardia? (c) Explain why the drug in (b) is considered safer than verapamil in the treatment of supraventricular tachycardia?