Example: Eye shape Almond-shaped eyes (A) are dominant to round eyes (a). One parent is homozygous recessive. The other parent is heterozygous. 1. Parent 1 2. Parent 2 phenotype phenotype genotype genotype 3. Punnett Square

Q: Q23 Name the region 7889 Q24 Name the structure Q25 Name the

A: Introduction  The kidney, ureters, and urethra make up the renal system. The system as a whole…

Q: Write down the amino acid sequence of the tripeptide shown below. CH3 H H₂N NH -NH,

A: The above given figure is of a tripeptide. Since we know that an amino acid sequence begins with…

Q: Write the name of disease associated with type 1, 2, 3 and 4 collagen.

A: Collagen is structural protein of the body that connects different cells and organs of the body to…

Q: Briefly the term viroids.

A: Viroid is an infectious particle smaller than any of the known viruses, an agent of certain plant…

Q: Answer please don't copy

A: The structures within the human body are maintained at several levels of structural organization.…

Q: _________ unwinds DNA.

A: DNA is the genetic material which is formed by the polymerization of nucleotides. DNA Store the…

Q: plzz explained prop

A: Bones are the metabolically active connective tissue that provides the structure support,…

Q: As you watch the video, answer the questions. The questions are in sequential order. 1) True or…

A: We are not supposed to use external links so answer are based in general point of view. Also in case…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: A ALEKS - Julianna Graham - Lex ← -> C +…

A: The complete mutated DNA sequences for both types of mutations (silent and non-silent) from the…

Q: What do you mean by tracrRNA?

A: Ribonucleic acid (RNA) is a single-stranded helical structure composed of a ribose sugar,…

Q: TUMOR SITE CAUSED BY THE FOLLOWING CARCINOGENS - (cadmium, arsenic, aflatoxin, nitrites, and…

A: Question - TUMOR SITE CAUSED BY THE FOLLOWING CARCINOGENS - cadmium arsenic aflatoxin nitrites…

Q: Name of the cancer antigen and theirs normal values

A: Following are some of the cancer antigen : CA 15-3 CA 19-9 CA 125 CA 27-29

Q: 2. On the skull diagrams below, color the bones of the skull (listed below) with different colors…

A: Skull It refers to the bones of the head. The skull comprises cranial bones and facial bones.

Q: Mutations conferring resistance to bactericidal agentssuch as __________ or bacteriophages

A: Bacteria are organisms that have a single cell and are considered the most primitive organisms on…

Q: A mutation in the DNA that codes for hemoglobin changes the sequence CTC to CAC. This will cause a…

A: The central dogma of molecular biology posits that information within a living organism flows from…

Q: The hypodent

A: The largest organ of the body is the skin. The skin is formed of several subunits. The three…

Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: Robert Hooke produced of his findings under the microscope drawings pictures

A: Robert Hooke discovered the cells first in a piece of cork and also coined the term cell. He…

Q: Which suspect is linked to the crime scene by this DNA analysis Suspect A Suspect D Suspect C…

A: DNA fingerprinting is a technique used by scientists to differentiate between individuals of the…

Q: Zイ PS 22

A: Prophase

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: Lab #3 Part B Comparison Specimen 2 and 3 with Exemplar 1.

A: A Comparison of Glass Specimens is the Subject of the Analysis of Lab #3 Part BIn the first picture,…

Q: The kind of mutation where one nucleotide is exchanged for another different nucleotide, which may…

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is formed of the…

Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .

A: In cells, different parts have specific jobs in making and controlling proteins. One important part…

Q: What is being hidden during the encircled wave? R P.

A: An electrocardiogram (ECG) is a simple test that can be used to monitor your heart rate and…

Q: What are the key differences between rough endoplasmic reticulum and smooth endoplasmic reticulum.…

A: The cell is the structural and functional unit of an organism that perform all the activities. The…

Q: Question:-

A: There are many microbes that infect the oral cavity. The microbes that infect the oral cavity…

Q: _____________ are short nucleic acid segments containing 50 nucleotides or less.

A: Primer Oligonucleotides are nucleic acid segments containing 20-30 nucleotides

Q: ㅁ -1

A: A flower is a part of a plant classified as an angiosperm. Angiosperms are plants that produce…

Q: Label name correctly please answer me

A: We know that The muscular system is formed by the muscles of the body that are soft tissues and are…

Q: Identify and describe the functions of cells indicated by # 1 (green) and # 2 (blue). Identification…

A: The skin is the biggest organ in the body, accounting for around 15% of total adult body weight. The…

Q: the structure of plasmodium parasite/ malaria?

A: Plasmodium is a unicellular parasite that causes malaria, a disease that affects millions of people…

Q: Select one: O a. stomach O b. spleen Oc. small intestine O d. pancreas

A: The given first diagram shows the human digestive system.  The second picture shows the part of…

Q: A,

A: Meosis is the type of cell division which resukts in the formation of the gamete.  In humans the…

Q: Question 26 SHORT ANSVWER (recall) What is the SIZE of an average gene? (give a range, in bp or kb)…

A: The nucleus of a cell contains the nucleic acids which are responsible for the passing down of…

Q: 1. Larry Martin and David Burnham (U of Kansas) made their 3-D model of microraptor from a mold of a…

A: Microraptors are small, four-winged dinosaurs. They contain 2 pairs of feathers one in the for limbs…

Q: +…

A: To determine the base sequences for a silent mutation and a non-silent (or missense) mutation in the…

Q: Label please help

A: We know that The human mind has a similar fundamental structure as other well evolved creature…

Q: 김 OTO 영

A: A pedigree is a family tree or chart made of symbols and lines that will represent a person's…

Q: 15-16. The ______ ( name the structure at the orange arrow) is attached to the ______ (name the…

A: In case of internal fertilization the embryo develops within the mother body. After completing the…

Q: Why is it necessary for pregnant women to strengthen their “pelvic floor”?

A: Pelvic floor is a muscular floor located at the bottom of the abdomen that stretches from the…

Q: an`s decreased body was found. Her death was considered suspicious. Lab results from the medical…

A: Cyanide is a chemical group containing cyano group, which is C=N. Exposure to several forms of…

Q: Method of preparing aqueous cream BP

A: Aqueous cream BP  Aqueous cream BP is and ointment which is use to treat dryness of the skin. It is…

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.