Example: Eye shape Almond-shaped eyes (A) are dominant to round eyes (a). One parent is homozygous recessive. The other parent is heterozygous. 1. Parent 1 2. Parent 2 phenotype phenotype genotype genotype 3. Punnett Square

Q: -A wild-type strain. -A strain that contains a 15 base-pair deletion in the lac operon operator…

A: The widely used and closely related Escherichia coli "wild types" W3110 and MG1655, as well as…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: Please help me answer this question

A: A compound of hydrogen and carbon, such as any of those which are the chief components of petroleum…

Q: A ALEKS - Julianna Graham-L x + New Chrome available…

A: Background on Semi-conservative ReplicationSince DNA replication is semi-conservative, one strand…

Q: Spine reflection

A: The controlling system of the body which is composed of nerve cells and organs is called the nervous…

Q: Well firm - limited smooth bulge on the hard palate of this 67 year old woman, painless so what is…

A: Introduction - Cancer is a broad term that describes a variety of disorders characterised by the…

Q: Aphakia and it's correction

A: Eye- The eye is one of the sense organs of the body which is used for seeing different objects. The…

Q: 1. Observe the photograph of the gel containing your sample. Orient the photograph with wells at the…

A: In this exercise, we are presented with a photograph of a gel containing samples, possibly from a…

Q: Appendicular S

A: Bone is a metabolically active connective tissue that aids in mobility, protects essential organs,…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: still waiting on my answers to my questions

A: In the medical field, accurate coding is essential for billing and reimbursement purposes. Proper…

Q: Incomplete answers did not answer 5 questio ns

A: In a given condition patient is suffering from bilateral pain so the doctor prescribed her NSAIDs.…

Q: B A- E- A U D E ✓ B ✓ F- vi G- H F G D- ✓ H-

A: The image is of brain and its different parts. Brain is the most important regulatory organ of the…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: Fibrocartilage (____×)Location _______________________ Function _______________________

A: As we know human body is made of skeleton. Skeleton is structure that keeps body in shape and helps…

Q: Definition of IP3

A: Cell signaling is the process of communication between cells. It occurs with the help of various…

Q: functional segmentation

A: Segmentation is the division of the body of some animals and plants into repetitive segments.…

Q: 外 13 A ING 11

A: The given diagram is of the base of skull.

Q: Can you help me with this picture

A: Anatomy is the part of science concerned with the investigation of the design of organic entities…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: attach

A: The given diagram is of ANTIGEN PRESENTATION to a defence cell of the body so that it recognises the…

Q: Inside view of edge. Note hacklemarks.

A: Tissue Response to Mechanical Stress1. Microtrauma and Microfractures:• Similar to hackle marks in…

Q: Figure 9.1 Using Figure 9.1, match the following: 37) Endomysium. 37) 38) 38) Fascicle. 39) The…

A: Muscle fibers are made up of muscle cells and help control movement of different parts of the body.…

Q: What is the Fischer projection of the nonulose structure above? H OH H OH HOH HOH H OH HOH H OH HOH…

A: The fischer projection of given nonulose structure is..  fischer projection is 2-D image of 3-D…

Q: Adding | [ Select ] to the media will increase the germination rate of seeds the type typically…

A: Seed germination is a process in which a plant emerges from a seed under favourable conditions of…

Q: Neoplesia ( definition, classification, nomenclature, causes and staging) At least four pages from…

A: Trillions of cells made the body that divides, grow, and die. This process is controlled and…

Q: Chronic kidney disease treatments

A: Chronic kidney disease is a long term  condition with progressive and irreversible condition of…

Q: 1- 8, 2.

A: Histology is a science that studies the tiny anatomy of biological tissues. It is also recognized as…

Q: Letter D please what is called!

A: The smallest structural and functional unit of an organism is known as cell which contain different…

Q: All the items in question 2 including sub-questions a, b, c, and if possible d, as well. Much…

A: DNA (deoxyribonucleic acid) is composed of nucleotide bases that are in turn made up of nitrogenous…

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.