Q: Explain the difference between Place and Stimulus-Response learning strategies. Include the…
A: The activation of Brain sources that occur in response to auditory, visual and audiovisual stimuli…
Q: Scientists have discovered a new species of bird in Mexico that migrates South to the Amazon…
A: The process of animals migrating over great distances in search of food and shelter, as well as to…
Q: A series of two-point crosses were carried out among five loci (E, F, G, H, and I), producing the…
A: When two genes are near enough on the same chromosome, they are considered to be connected because…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: Give the PLOIDY of the following (ex: haploid, diploid, etc…) 1. oospore 2. prothallus 3. androcyte…
A: Ploidy can be defined as a total number of sets of chromosomed present in a nucleus of a cell.…
Q: The mating below shows the sex chromosome found in two parents and their resulting offspring. FMR1…
A: Introduction An organism's genotype is its entire set of genetic material. The alleles or variants…
Q: Give at least 5 observations from the structures based on fish dissection?
A: Given: For the fish dissection procedure one would require, Medium sized - fish to visualize all the…
Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…
A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…
Q: QUESTION 8 The mating below shows the sex chromosome found in two parents and their resulting…
A: The fragile X mental retardation protein is encoded by FMR1, which is found on the X-chromosome…
Q: You are investigating the loss of activity of a particular enzyme in a mutamt bacterium. You…
A: The activity of an enzyme is micromoles of product formed per minute. The enzyme interacts with to…
Q: 1. Plants are classified into three types based on water availability in its habitat. What are these…
A: The plant body is complex, made up of several systems. Each system in the body has a distinct…
Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…
A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…
Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.
A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…
Q: 1.Fatigue is caused because of formation and depositing of which among the following acids in…
A: Introduction Fatigue:- It is a term used to describe an overall feeling of tiredness or lack of…
Q: with the Lactose negative go to the Serratia liquefaciens? What does Enterobacter aerogenes causes…
A: Answer
Q: To describe: The ecological niche of humans.
A: The intended function that an organism performs within an environment is its niche.The biotic…
Q: To explain: Whether humans are dominant species or key ştone species.
A: A species is a group of organisms with genetic similarities, the ability to interbreed, and thus the…
Q: i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: 1. ____ are phospholipid with serine at coe that forms rafts that float about within the membrane.…
A: A phospholipid is a lipid with a phosphate group that is found in large amounts in cell membranes.…
Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…
A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…
Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…
A: As stem cells are the cells which have the ability to divide and can give rise to many different…
Q: Match the pieces of the negative feedback arc that regulated the increase in stroke volume seen…
A: Answer given in step 2. Thank you.
Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…
A: Protein phosphatases (PPs) regulate a wide range of signalling systems in plants, and their blockage…
Q: Which of the following organisms practice internal fertilization and external development. Chickens,…
A: Introduction :- Internal fertilisation is the joining of an egg and sperm cell inside the female…
Q: Many amino acid biosynthetic operon under attenuation control are also under negative control.…
A: In bacteria, transcriptional attenuation is a common means of regulating gene expression in response…
Q: Sign in Draw Design Layout References Mailings Review View Help Tell me what you want to do nswer:…
A: Polymer are made up of many monomers. The polymerization reaction allows the formation of different…
Q: Explain how an excessive input of phosphate ions into a body of water such as a lake can have a…
A: phosphate is a major nutrient needed for life. Phosphate is the most common form of phosphorus, used…
Q: 8. Which of the following statements about oxytocin is correct? A. Dilation of cervix and baby…
A: Oxytocin is a hormone delivered by the pituitary organ that causes expanded expansion of the uterus…
Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: Compare and contrast the difference between a prehistoric organism and modern-day organisms. What…
A: Answer
Q: To examine: Whether the statement "most intracellular signaling pathways provide numerous…
A: Cell signalling, also known as cell-cell communication, is responsible for directing the basic…
Q: Was LUCA likely an RNA-based or DNA-based organism? Why?
A: Answer
Q: This pedigree chart shows the transmission of a trait in a particular family. Based on this pattern…
A: Answer is mitochondrial pattern of transmission. In mitochondrial transmission, disease is…
Q: The erythrocyte sedimentation rate (heaviness) testis oftenusedfor a blood sample as a diagnosis of…
A: Erythrocyte sedimentation rate: The erythrocyte sedimentation rate (ESR or sed rate) is the rate at…
Q: I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A…
A: Forensic analysis using DNA samples The DNA sequences can be a helpful tool to determine the…
Q: Which of the following Does not describe the juxtaglomerular com Its granular cells produce rennin…
A: In kidney, juxtaglomerular compartment is the key regulator of the functions of each nephrone. It is…
Q: 2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours…
A: Alchohol consumption leads to decrease in hormone production.
Q: Why do we use samples in the collection of d
A: Data Collection process is the collection of data in the form of samples for the proposed variables…
Q: how an angiotensin converting enzyme inhibitor ACE such as captopril would effective as an…
A: Anti hypertensive means the drug causes the reduction in blood pressure. Normal blood pressure is…
Q: S-phase arrest in response to glutamine deprivation in KRas-driven cancer cells can be reversed by…
A: The shortage of deoxynucleotides required for DNA synthesis causes KRas-driven cancerous cells to…
Q: Can gelatin hydrolysis be correlated with the pathogenicity of a bacterium? Explain your answer
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…
A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…
Q: Galactosemia is a recessive human disease that is treatable by restricting lactose and glucose in…
A: Galactosemia is a recessive human disease that is treatable by restricting lactose and glucose in…
Q: The 2C units of acetyl CoA necessary for fatty acid synthesis in the cytosol comes from the 6C…
A: Fatty acid synthesis It is the process of the formation of fatty acids from 2 carbon molecules…
Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.
A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…
Q: discoideum) occasionally aggregate into a colony. About 20 percent of the amoebae in the colony make…
A: Kin selection favors the reproductive success of the other relatives even at a cost to the…
Q: O Ferquency O haematuria O oliguria
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: 3 ANE .MOO城が
A: The plasma membrane, also called the cell membrane, is the membrane found in all cells that…
Step by step
Solved in 2 steps with 2 images
- The average length of double helix in human chromosome is 3.8cm. 1. Approximately how many base pairs would be present in such a chromosome?____________(no spaces and comma) 2. If the strand of nucleotide is 200,000 bp, give the length in micrometers.__________(no spaces)13. a. Draw in the corresponding DNA nucleotide that would base pair with the adenine nucleotide shown below using the same level of detail as provided in the image below. Hint: Remember that DNA bases pair in the antiparallel orientation. орасна you A OH H b. How do you know the adenine nucleotide drawn above is from DNA and not RNA?7. The mole fraction composition of one of the strands of a double-helical DNA molecule is [A] = 0.30 and [G] = 0.24. (a) What can you conclude about [T] and [C] for the same strand? (b) What can you conclude about [A], [G], [T], and [C] of the complementary strand? (c) If [A] = 0.22 for the complementary strand, how many hydrogen bonds would this double-helical DNA molecule have if it were 100 base pairs long?
- 2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA 5'GCTTGATCAGCTAGTCCATC GATCGGTCCTCGGAGCCCATTAAGGTAGC 3' DNA 5' 3'CGAACTAGTCGATCAGGTAGCTAGCCAGGAGCCTCGGGTAATTCCATCG mRNA 5' Protein Alanine Arginine Aspartic Acid ASP Asparagine ASN Cysteine CYS Glycine Glutamic Acid GLU Glutamine Histidine Isoleucine Leucine Lysine ALA Proline Serine ARG GLY GLN HIS ARDNUGEO H А с ISE I LEU L LYS K Methionine MET M Phenylalanine PHE F PRO P Tyrosine Tryptophan TRP Valine VAL SER S Threonine THR T TYR Y <हर First letter UUU Phenyl- UUC alanine G UUA UUG CUU CUC CUA CUG A AUA AUG AUU AUC Isoleucine GUU GUC Leucine GUA GUG Leucine Methionine; start codon Valine UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter Serine Proline…1. Write the complementary base sequence for the matching strand in the following DNA section: -A-G-T-C-C-A-A-T-C–1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) TAAGCTAG3' DNA 5'GAGATCGATGTCCATCGATCGATCGAATTCGGAGCCAATT DNA 3'CT CTAGCTACAGGTAGCTAGCTAGCTTAAGCCTCGG TTAAATTCGATC 5' mRNA 5' Protein
- 1. You are given with the DNA sequence in the leading strand template. See item number 1 in worksheet, row A. Supply the information asked for in the succeeding rows: row B: supply the bases in the complementary strand. row C: Assuming that the sequence in the 1st row is the template for transcription, supply the bases of the MRNA transcript. Label the 5' and 3' ends. row D: Identify the amino acids that comprise the polypeptide chain as the ribosome would have identified them. Just merge cells before you label the amino acids based on the codes. Label the 5' and 3' ends. 2. Complete the necessary information. Answer the guide questions. A. Replication, Transcription and Translation. Use BLUE FONT COLOR for all answers. 1. This is the DNA sequence in the leading strand template. Follow the instructions given on page 75 of module 3. 5' T. T G A 3' 3' 5' ABCD7. Each nucleotide pair of a DNA double helix weighs about 1 × 10–21 g. The human body contains approximately 0.5 g of DNA. How many nucleotide pairs of DNA are in the human body? If you assume that all the DNA in human cells is in the B-DNA form, how far would the DNA of a cell reach if stretched end to end?4b) What is the functional difference between heterochromatin and euchromatin? In other words, what can a cell do (or not do) with euchromatic DNA but not heterochromatic DNA?
- 14. For the diagram at right, please label the following words on the diagram. (A) Deoxyribose (sugar), (B) Phosphate, and (C) Nitrogenous Base. 15. Based on the definition, how many nucleotides do you see in this diagram? 16. What are the four different types of bases in DNA and how do they pair? 17. When studying heredity, what is the relationship of DNA bases and traits?10.) Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent the sequence: A G T A C C G G G C A A Note: It should include items to represent - sugar molecules - phosphate molecules - 4 distinct nitrogenous base molecules (Adenine, Thymine, Cytosine, and Guanine) - two types of bonds between these molecules34. Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure.