(е) CH,CH;–{– CH;CH,–Ñ-ċ-Ph CH;CH-Č-0-Ph CH;CH-0-ċ-Ph

Q: Define the term “kiss-and-run fusion”?

A: Introduction: Hormones and neurotransmitters get released from neurosecretory cells via the fusion…

Q: Hematopoietic stem cells in the bone marrow of adults .. O a) are multipotent, in that they can…

A: Introduction Hematopoietic stem cells:- It is an immature cell that can develop into all types of…

Q: Determine whether each of the statements describes amyloid beta (AB) in Alzheimer's disease (AD),…

A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…

Q: Download and read the attached review article…

A: Some cancer patients would only need one operation. Many patients, on the other hand, undergo a…

Q: For what the term 'humulin' is used?

A: The hormone insulin is a peptide hormone that enhances the transport of glucose from the blood into…

Q: 5. Link the following 3 proteins with the most appropriate 3 cancer hallmarks: a) Matrix…

A: Introduction:- Cancer is a disease that develops when cells divide uncontrolled and spread…

Q: 1. Which of the following is true of a maternal effect? A) The gene is located in the nucleus. B) It…

A: Maternal effect produces when specific phenotypes of offspring are controlled by the factors that…

Q: Either 0 or 1 amino acids change. -1 adenine is replaced by cytosine. Either 1 or 2 amino acids…

A: One adenine replaced by cytosine Answers One amino acid is change Reason Such type of mutations is…

Q: A. What do scientists do to adult cells to make them “behave” like embryos?  B. Transgenic, cloned…

A: The embryo is formed from the fusion of the male gamete and the female gamete in the process of…

Q: The development of colon cancer is particularly well- studied, and often has a predictable order of…

A: Colorectal cancer (CRC) is the 1/3 most frequent cancer in men and the 2nd most frequent cancer in…

Q: How has DNA technology advanced the reconstruction of one-living and currently-living organisms? B.…

A: We have known that an organism's DNA affects how it looks, how it behaves, and its physiology. So a…

Q: if you know the amino acid sequence of a protein can you predict with 100% certainty the DNA…

A: Codon is the genetic code that is formed by permutations and combinations of three nucleotide…

Q: To examine: Whether the given statement, "each member of the human hemoglobin gene family, which…

A: Many double-stranded linear is generally defined that they are the  DNA molecules that make up the…

Q: B. How does conjugation differ from normal sexual reproduction?

A: The bacteria can reproduce by both sexual and asexual modes of reproduction.Bacteria are microscopic…

Q: Which of the cells in the diagram will eventually develop into macrophages? Courtesy Michael Ross,…

A: Leukocytes, also known as WBCs or white blood cells, consisting of minute particles called…

Q: What is “EMLA”? Give its purpose?

A: A human being's nervous system is a complex system that helps to coordinate behavior and transmit…

Q: Children with EB might need feeding tubes.  What is a gastric feeding tube?  How does it work…

A: Epidermolysis Bullosa (EB) is a hereditary condition that interferes with intercellular adhesion and…

Q: What is an epitope? What is a hapten?

A: Immunogens are substances that can produce an immune response. Antibodies are Y-shaped…

Q: Describe PMCA and cancer

A: Cancers are known to be the state of the cells in which the cells divide uncontrollably due to…

Q: State and describe the benefits of using whole-genome sequencing for diagnosis.

A: The whole genome shotgun method involves cloning, followed by accurate computer sequencing of the…

Q: why wxactly 20Atp not 24?

A: Acetoacetate and hydroxybutyrate are ketone bodies that are used by cells (especially brain cells)…

Q: Outline the steps of post-translational sorting of proteins tomitochondria.

A: Mitochondria are one of the most important organelles of a cell. These cells are essential to the…

Q: B. Describe in complete sentences how you would identify a target DNA cleavage site for CRISPR-Cas9…

A: A target DNA cleavage site would have PAM sites - 5' NGG flanking both sides of the target.In the…

Q: Define any five Natural Products with MedicalApplications ?

A: Answer: Introduction: A natural product means a chemical substance formed by a living organism or…

Q: Number 10

A: Hemophilia is defined as a bleeding disorder where blood does not clot normally and this is…

Q: Regarding albinism, name and briefly describe diagnostic procedure(s) that can be used to detect the…

A: The term albinism usually refers to oculocutaneous albinism (OCA). It is a set of genetic illnesses…

Q: Briefly describe the grafting process.

A: Grafting is the process of joining two plants together to grow as one. The upper portion of the…

Q: Describe the seven hallmarks of cancer i) List the seven hallmarks ii) Connect each hallmark to…

A: Weinberg and Hanahan gave 6 of the hallmarks of cancer in 2000 and then added 4 additional hallmarks…

Q: Q 21 Q 22 Give a fuinction of Q22

A: The female reproductive system is formed of external and internal organs. The external organs…

Q: #6) Histological work suggests that colon cancer develops in a multistep fashion. Which of the…

A: ANSWER) (5) a, b and c Colonoscopy is the medical procedure for detecting the abnormal changes in…

Q: What is the most important gene in the XIC?

A: XIC is the X- inactivation center present on the q (long) arm of X chromosome. This region includes…

Q: A. What is random mutagenesis? B. How many people a year die due to insecticide misuse and exposure?

A: Selective breeding practises having existed for crops ever since man started cultivation. So there…

Q: Define Henle’s Loop.

A: Animals produce different types of nitrogenous waste as a result of various cellular reactions…

Q: 4 Draw a map showing the order of the genes that enter the F- cell for the figure on the right. Hfr

A: The plasmid mapping is given in the figure. The F- is the recipient cell.

Q: To determine: The information gained about the function of WDR62 from the DNA sequence of the normal…

A: Introduction Genome:- The genome is the entire set of DNA instructions found in a cell,  In living…

Q: For the P53 gene, briefly summarize relevant disease information and provide molecular diagnosis…

A: Carcinoma can kill when it infiltrates vital organs such as your liver, lungs, or brain and prevents…

Q: A. Describe in complete sentences how the requirement of a PAM sequence affects the flexibility of…

A: To make specific changes in organism's DNA scientific found a method, this method is known as gene…

Q: . Give an example of a DNA-repair defect that leads tocancer

A: Cancer results when body mechanism fails to control the cell division that has lost the control…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: 11. Differentiate pUC18 from PBR322 (Give two differences).

A: Plasmid : It is a circular dsDNA molecule . Naturally occurring plasmids are viruses of bacteria.…

Substance Abuse

Substance abuse refers to the use of illegal drugs in excessive quantities, as well as the misuse of legal substances such as prescription or over-the-counter pharmaceuticals or alcohol for purposes other than those intended. Drug addiction, also known as substance use disorder, is a disease that affects the brain and behavior of a person. It leads to a failure to control the use of any drug or prescription, legal or illegal.