Answered: E 3 10 MYA Genetic Relatedness Consider…

E 3 10 MYA Genetic Relatedness Consider the phylogeny above. The two extant (living) species that are most closely related to each other are A and E Time

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter20: Phylogenies And The History Of Life

Section: Chapter Questions

Problem 7RQ: On a phylogenetic tree, which term refers to lineages that diverged from the same place? sister taxa...

See similar textbooks

Related questions

Q: The phylogenetic tree below depicts the evolutionary relation among a subset of ants. The Taxa…

A: These groups are also known as clade. This includes a group of organisms that has a common ancestor.…

Q: Molecular clock techniques are used to calibrate radiometric clocks measure the genetic distance…

A: Molecular molecular clock technique are used to Answer : Estimate when to taxa diverged from a…

Q: B C D E GH I5 Using evidence from the phylogenetic tree determine which species would be MOST…

Q: For which of these groups is the biological species concept not useful for determining species? Mark…

A: Nonsexual groups and Extinct groups (fossils) are the groups in which biological species concept…

Q: Scientific evidence documents the pattern of evolution. The evidence exists in a variety of…

A: The change in heritable characteristics of the population that are passed on in several generations…

Q: Snakes evolved from ancestors who had the ability to walk. Some snakes, in fact, still have small…

A: Vestigial structure are the structure that are non - functional or useless or lost in present…

Q: Recent reconstructions of evolutionary history are often dependenton assigning divergence in terms…

A: The molecular clock is the clock that is used to measure the mutation that gets accumulated in the…

Q: 2 Indicate in the following cladogram? A -B E The point at which species C and D diverged The common…

A: In the following cladogram, the correct answer is the last option which says the point at which…

Q: 口。 G F C DA B h of the following statements about this phylogenetic tree is correct? is more closely…

A: The image shows a phylogenetic tree which depicts the relatedness between different species.…

Q: A review of the phylogenetic tree shows a common ancestor for these vertebrates. Which statement…

A: Phylogenetic tree of vertebrates showing common ancestor.

Q: Snakes evolved from ancestors who had the ability to walk. Some snakes, in fact, still have small…

A: Evolution is a continuous process and we are still evolving. Evolution is nothing but adapting to…

Q: Imagine that you have the DNA sequences fromthe intron of a gene in three species called A, B,and C.…

A: We use the Distance method , more accurately the Unweighted Pair Group Method with Arithmetic mean…

Q: What inference can be made from the phylogenetic tree? Present Day A E F G A B DC Past A O a Species…

A: Phylogeny represents the evolutionary relationship between the taxons.

Q: Identify the outgroup from the phylogenetic trees and box/mark the whole lineage in red. Identify…

A: Introduction The diagrammatic representation of the evolutionary link between organisms is the…

Q: The image above represents a simple cladogram for the primate order, where the letters are nodes and…

Q: 2. Based on the phylogeny shown, we can conclude that species 2 is most closely related to species…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: No relation between A and B I Common ancestor between A and B A B C D E F 닌 I What is the arrow…

A: Phylogenetic trees are used in biology to demonstrate evolutionary relationships between species.

Q: Why are simpler structures considered ancestral when we study phylogeny? * 1 point Complex…

A: In the course of evolution, the living organism have started from a mere cell and that too…

Q: Below is a phylogeny depicting the relationship among eight animal species (A to H). Next to the…

A: Phylogeny represents the evolutionary history of an organism. Phylogenetic tree represents the…

Q: Macroevolution deals with the evolution of new species that takes place over long periods of time…

A: Macroevolution is a word that relates to evolution that occurs above the level of a single species.…

Q: A C E J K O a. A trait unique to species G is best described as a plesiomorphy among all taxa. O b.A…

A: Phylgeny represents the evolutionary relationship between the taxons.

Q: Three living species X, Y, and Z share a common ancestor T, asdo extinct species U and V. A grouping…

A: On the basis of the given information, it can be inferred that a phylogenetic tree or evolutionary…

Q: Tree 1 Tree 2 Tree 3 outgroup A В C outgroup В C A outgroup A We have gathered some morphological…

A: Evolution can be defined as the occurrence of the natural phenomenon in which species developed new…

Q: pring lat survive embryologic development. What can you conclude about the banana slugs? * O…

A: The biggest characteristic of the species is that they are able to produce fertile offspring after…

Q: Similar anatomical structures shared by related species are called. Palatial Structures O Homologous…

A: Anatomical features of several organisms are compared to understand structural similarities and…

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

Q: Describe the process of speciation through geographic isolation.

A: The process through which populations develop into different species is known as speciation. In…

Q: Snakes evolved from ancestors who had the ability to walk. Some snakes, in fact, still have small…

A: The evolution is defined as the change in trait of a species over a period of time.

Q: Currently, two of the extant porpoise species (Y and Z) are placed in the genus Tursiops, and a…

A: Phylogenetic tree is also known as the evolutionary tree. This diagram depicts evolutionary…

Q: Which of the phylogenetic trees below represent the same evolutionary relationships? Tree 1 Tree 2…

A: A phylogenetic tree represents the evolutionary relationships (origin, similarities and…

Q: Tree 1 outgroup A Species Outgroup A B с B Number of toes Eye color Tail C outgroup Number of molars…

A: Evolution can be defined as the occurrence of the natural phenomenon in which species develop new…

Q: O Biological O Phenetic O Phylogenetic O Parasympathetic 200 A-beaver Dam, AZ B-Twentynine Palms, CA…

A: Introduction Classification means the arrangement of various species into a groups. In the world…

Q: Within a diploid animal species, what are potential sources of variation in shared, heritable…

A: Evolution is the gradual accumulation of changes in organisms over a period of time. The theory of…

Q: What is a vestigial structure? * O A feature inherited from ancestors that has lots its original…

A: Actually different types of tissues that have a similar function together form an organ inside the…

Q: 0. Refer to the figure shown. Species Stripe 1 2 Color R G The figure shows the phylogeny of seven…

A: Evolutionary reversal is a concept in which a particular trait from the previous ancestor is lost…

Q: The diagram represents a possible phylogenetic tree showing the relationship between the four…

A: The phylogenetic tree is the diagrammatic representation of the evolutionary relationship of the…

Q: To test evolutionary hypotheses, you make a phylogeny of a group of organisms based on six traits.…

A: The diagram shows a phylogenetic tree showing relationship between different organisms.

Q: Think about the ways we define/identify a species. What would the least precise way to determine a…

A: According to the Biological Species Concept, a species is defined as a group of organisms that can…

Q: A molecular clock assumes that the genes used in an analysis O are evolving slowly. O alter their…

A: In some cases, DNA differences can be linked to absolute dates of divergence based on the fossil…

Concept explainers

Paleontology

A branch of science concerning the scientific study of life from ancient times is known as paleontology. The scientists working on paleontology are known as paleontologists. Paleontologists collect the fossils of organisms from ancient times to classify them. The paleontologists also study the environment from ancient times to study the interactions between different organisms.

Question

Present
B
E
A,
5
3
4
10 MYA
Genetic Relatedness
Consider the phylogeny above. The two extant (living) species that are most
closely related to each other are
A and E
C and D
D and E
A and B
B and C
Time

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Phylogeny question
Rectangular Snip Which of the following is the common ancestor of organisms E, F, G, H? В E IV II H. LIL
a. Phylogenetic relationships based on chloroplast genes Brown algae Diatoms Most photosynthetic dinoflagellates Cryptophyte algae Red algae Red algae Green algae Euglenids Green algae Chlorarachniophyte algae Green algae Green algae Green algae Green algae Land plants Glaucocystophytes Cyanobacteria b. Phylogenetic relationships based on nuclear genes Opisthokonts Amoebozoans Glaucocystophytes Red algae Green algae (including land plants) Cryptophyte algae 140000 Diatoms Brown algae Dinoflagellates Chlorarachniophyte algae Chloroplast genes relate brown algae, diatoms, most dinoflagellates, and cryptophyte algae to red algae, which is different from the relationships based on nuclear genes shown in part b. -Excavates Chloroplast genes relate euglenids and chlorarachniophyte algae to green algae, which is different from the relationships based on nuclear genes shown in part b. Chloroplasts form a monophyletic group nested within cyanobacteria, providing strong evidence for the…
Activity 4. The Cladogram Direction: With the cladogram below as a basis, answer the following questions in the space provided. Skin shields Two Horn moil bogsvih ya Horn owi tarl A hypothetieal cladogram with taxa designated as the letters O, A, B, C, and D. Retrieved from Kardong (2012) Fig. 1. Which is the outgroup here? O, A, B, C, or D? 2. Which is the sister of the group of D? 3. Grouping A, B, and D together (excluding C) creates which kind of grouping? 4. Which taxa share the characteristic of "skin shields"? 5. What characteristic is homologous among A, B, C, and D? 30 6. Write down the taxa that would make a paraphyletic grouping. 7. Write down the taxa that would make a monophyletic grouping. 8. Which characteristic is absent in O but is a homologous characteristic among A, B, C, and D? 9. Which is a unique characteristic present in A, B, and C which is absent in D? 10. Will grouping O, A, B, C, and D create a valid clade?
Phylogenetics vs. Linnaean Taxonomy.
Question: Which statement is TRUE about the phylogenetic tree below? 74 79 0.020 79 100 -Sardinella fimbriata -Sardinella albella - Sardinella tawilis - Sardinella gibbosa Sardinella lemuru -Sardinella longiceps -Escualosa thoracata Engraulis encrasicolus Figure 1. Neighbor-Joining Tree of Sardinella spp. inferred using cytochrome oxidase subunit 1 (CO1) gene. S. fimbriata is closely related to S. albella than to the rest of the Sardinella species. S. tawilis is closely related to S. lemuru than to S. gibbosa. E. thoracata cannot be considered as an outgroup. S. lemuru is distantly related to S. tawilis than to S. fimbriata.
A. Basic Phylogenetic Tree Construction: Create a phylogenetic tree which best represent the data provided: Species Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 Guinca pir present present albsent present Camel alosent absent present absent Capvbara prescnt present absent present Species Enzyme 1 Enzyme 2 Enzyne 3 Enzyme 4 Opusurn present presenl pnesent present Plalypus ppresent present pnesent alsennt Chit ken prment atrent ataent atrsent B. Encircle Monophyletic groups that can be found in this tree. Angus cattle White-tailed deer Blue whale Pygmy hippopotamus Extinct Wild boar Mammal Alpaca Based on the phylogenetic tree above, what species is most related to the blue whale?
uestion 35 Based on the phylogenetic tree below, which of the following species has hair? Hair Hinged jaw Vertebral column (backbone) Common Ancestor -II IV O a. Species III O b. Species IV O C Species I O d. Species II
Question: Which statement is FALSE about the phylogenetic tree below? - Sardinella fimbriata - Sardinella albella - Sardinella tawilis - Sardinella gibbosa -Sardinella lemuru - Sardinella longiceps -Escualosa thoracata -Engraulis encrasicolus Figure 1. Maximum Parsimony Tree of Sardinella spp. inferred from COX1 gene. 66 88 100 The clade formed by S. lemuru and S. longiceps is strongly supported. S. albella is closely related to S. tawilis than to S. longiceps. E. thoracata is closely related to E. encrasicolus than to the rest of the Sardinella species. Both S. frimbriata and S. albella are closely related to S. gibossa than to S. longiceps.
Drawing of organism: Domain: Kingdom: Division/Phylum: bsovnos brs wollod (mo01 od ot wollsy suer toos ons Genus: Species: Distinguishing features: nd isb seaUsz to elmetsioleeim possesses Common name: Scientific name: Drawing of organism: Domain: Kingdom: onntiv of chiorophyll pigts Division/Phylum: hich inay or may not incude cond or ovetho which are thick.cylindrical, and spongy, dar'sgro Codium fregile (dead man's Genus: Species: Distinguishing features: Common name: bau2 b Scientific name:
Part B- Phylogenetic trees and geographic relationships The island fox, Urocyon littoralis, is endemic to the Channel Islands, which are located off the coast of southern California, Six of the eight Channel Islands support fox populations, and each of these islands is home to a distinct subspecies, as shown in the table below. Island Subspecies Santa Cruz santacruzae Northern Chanel Islands Santa Rosa U. I. santarosae San Miguel U. I. littoralis San Nicolas U.I. dickeyi Southern Channel Islands San Clemente U.I. clementae Santa Catalina U.I. catalinae The island fox shares a common ancestor with the gray fox. Urocyon cinerecargenteus, which is found on the mainland. Both species have similar coloration and a diploid chromosome number of 66. One structural difference between the two species is the reduced size of the island fox, a feature known as dwarfism. The various island subspecies also differ from each other in size, number of tail vertebrae, and other characteristics The…
Please help to creating parsimonious treesFor the following DNA sequences determine the most parsimonious phylogeny. Tree ASpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AATGTCGGGATATATCGCGGGGAAATTTACGACTSpecies 3 AATTGCGGGATATATCGCGGGGAAATTTACGACT Tree BSpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AACTGCGGCATATATCGCGGGGAAATTAACGACTSpecies 3 AAGTGCGCCATATATCGCCCGGATAATTTCGAGA Tree CSpecies 1 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 2 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGCSpecies 3 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 4 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGC Tree DSpecies 1 GGGATATAGCGCACGATATCGTAGCCTAACGTTTTACGSpecies 2 GGGATATAGCGCACGATATCGTAAGCTAACGTTTTACGSpecies 3 AAAATATAGGCGTGGATATCGTAGCCTAACGTTGCATTSpecies 4 GGGATATACCGCACGTTATCGATCCCTAACGTTTTACG