Draw the structure of a dinucleotide formed by joining the 3'-OH group of dGMP to the 5'-phosphate in dAMP. 0 P-0 Но
Q: nt #2 nt #3 nt # 4 3. In the following sequence, which of these nucleotides a. would have a free…
A: a) Nucleotides #1 and #5, because the 5’ end of each DNA strand has a triphosphate group.
Q: Draw a tripeptide only containing Alanine
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: what is the adenine content
A: In double-stranded DNA, 3 hydrogen bonds form between guanine and cytosine and make them a pair. On…
Q: Outline the principle of how you would synthesise a library of approximately 1000 10-residue…
A: INTRODUCTION Oligonucleotide synthesis is the chemical synthesis of relatively short fragments of…
Q: draw a picture of a SINGLE strand of DNA (a polynucleotide) composed of 9 (nine) nucleotides of your…
A: Nucleic acids are made up of chains of many repeating units called nucleotides. The DNA molecule…
Q: Express the following DNA nucleotide bases into amino acids
A: According to the central dogma of molecular biology, the information stored in the DNA is first…
Q: So which form of the arginine side chain is the ionized form? And when the side chain is ionized the…
A: Arginine is an amino acid with a side chain that contains a guanidine group. In its conjugate acid…
Q: 5’ - A T G G C C C A A C T G A C C - 3’ a. How many nucleotides are listed here b. How…
A: Transcription is the process by which the genetic information encoded in DNA is copied into a…
Q: Draw the structure of the deoxyribonucleotide formed by joining two deoxyguanosine 5'-phosphates…
A: Deoxyribonucleotide is a structure that is made up of three basic parts: a phosphate group, a…
Q: Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What is the N-terminus? 2.What is…
A: The organic molecule is comprised of two functional groups that are an amino group and the carboxyl…
Q: fof NH HO-P-O-P-O-F `NH2 ÓH ÓH OH OH OH Which nucleotide is shown in the picture above?
A: A nucleotide is a molecule that is organic, containing a nucleoside and a phosphate. It is the basic…
Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…
Q: The structures of tRNAs contain several unusual bases in addition to the typical four. Suggest a…
A: The transfer RNA or tRNA acts as an adaptor molecule that is responsible for decoding the codons,…
Q: Identify the base shown below. Drag the correct base to the rectangle in the image O HN H₂N Adenine…
A: Introduction :- Guanine is a nitrogenous base that is one of the four building blocks of DNA and…
Q: (a) Draw the structure of the high-energy nucleoside triphosphate GTP. (b) Draw the structure of the…
A: In the biological system, there are several metabolic reactions that occur that result in the…
Q: 5-Bromouridine is known to induce mutations in DNA. One of the characteristics of this compound is…
A: 5-Bromouridine is a uridine subordinate with a Bromo substituent at the fifth carbon. Br -Urd is…
Q: Remembering that the amino acid side chains projecting from each polypeptide backbone in a β sheet…
A: Amongst secondary structures of polypeptide chains made of amino acids, β-sheets are a more spacious…
Q: Explain What are the four Deoxynucleotides?
A: Nucleotides are the building blocks of nucleic acid and they are ubiquitous molecules.…
Q: Draw the structure of the RNA dinucleotide formed between cytidine-5’-monophosphate and…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…
Q: nomenclature. o=-o- NH. 0- 0=P-O
A: Nucleic acids are the polymer of nucleotide. So, nucleic acids are also called as the…
Q: CH3 15 HN 9, *0-P-OCH2 5' 1' 4" 3' 2' Он LO
A: A nucleotide is an organic compound that acts as a polymer for the synthesis of DNA/RNA and it is…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: iven the structures of the nitrogenous bases below, draw the structure of a part of DNA with the…
A: The hereditary substance present in the cell is known as the genetic material. DNA acts as the…
Q: Consider the following pKa values: terminal amino group: 9.5; C = 8.2; Y = 10.1; K= 10.5; terminal…
A: Isoelectronic point is defined as the pH at which the amino acid does not move in an electric field.…
Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes…
A: DNA is the nucleic acid in the cell, which resides in the nucleus. It consists of the sequence of…
Q: Describe the steric interactions that determine the conformations that pyrimidine nucleosides…
A: Pyrimidine is an organic compound which has heterocyclic ring. It fuses with the nitrogenous bases…
Q: Predict the amino acid sequence based on the conditions below. Use the one-letter abbreviation of…
A: Amino acids are building block of polypeptide chain. its alpha carbon contains carboxyl group, amine…
Q: Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it…
A: nucleoside triphosphate, it provides our cell chemical energy and takes part in many cellular…
Q: Calculate the pl of the amino acid using the titration curve. 04 pH 0 6 8 SO 10 O 12.0 12 10.0 8.0…
A: Pi is the isoelectric point. This is the pH at which the Amino acid carries no net charge. The…
Q: if this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long.…
A: Given: DNA - molecular weight = 1.20 ×108 Dalton The molecular weight of a nucleotide pair = 600…
Q: Consider a short peptide that forms an alpha-helix within a larger protein structure. Suppose that…
A: Amino acids are the simplest units to form peptides and proteins. The amino acid sequences represent…
Q: The antibiotic cordycepin inhibits bacterial RNA synthesis. Solve, (a) Of which nucleoside is…
A: Cordycepin is an antibiotic, which also acts as an anti-inflammatory compound as well as…
Q: Draw the structure of Arg - Lys - Ser - Trp at ph 7.4
A: The proteins are biological macromolecules that are composed of twenty naturally occurring amino…
Q: The structure forms basenpair with what specific nucleobase?
A:
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Step by step
Solved in 2 steps with 1 images
- Draw the structure of a dinucleotide formed by joining the 3'-OH group of dGMP to the 5'-phosphate in dAMP. O=P. HOGiven the structures of the ribonucleotides as (shown in Image A) and deoxyribonucleotides (as shown in Image B), Draw the structure of the polyribonucleotide UAGCCUG and the structure of thepolydeoxyribonucleotide CGTAGAT.Draw the structure of a dinucleotide formed by joining the 3 '-OH group of dTMP to the 5 '-phosphate in dGMP.
- Draw the RNA dinucleotide formed if deoxyguanidine 5'phosphate and deoxythymidine 5'phosphate monophosphates undergo a condensation reaction. Label the 5' and 3' ends of your structure. 0-P-O-CH2 NH2 --P-O-CH2 Identify the phosphodiester bond. \H KH H. H H H H ОН H ОН H GDraw the structure of the RNA dinucleotide formed between cytidine-5’-monophosphate and adenosine-5’-monophosphate. Your structure should show cytidine with a free 5’ and adenosine with a free 3’.Draw the structure of the following nucleotide: adenosine 3'-monophosphate or guanosine 2-monophosphate
- Draw the complete structure of the trinucleotide deoxyribo-oligonucleotide that is complementary to 5'dTdGdA3'. Draw this completely, showing all atoms of all parts of the structure.Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphateThe enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure of this modified nucleotide.