Help Please! DNA and RNA are both information carrying molecules that are essential to all forms of life today.But what is the property of RNA that makes us think it was the first of these two molecules to evolve?O A. Unlike DNA, RNA uses the nucleotide uracil and not thymine.O B. Unlike DNA, RNA can fold into complex shapesO c. Unlike DNA, RNA can directly interact with proteins.D. Unlike DNA, RNA is much more reactive.

Nucleic acids The two main types of nucleic acids are DNA and RNA. Both DNA and RNA are made from…

DNA and RNA are both information carrying molecules that are essential to all forms of life today. But what is the property of RNA that makes us think it was the first of these two molecules to evolve? A. Unlike DNA, RNA uses the nucleotide uracil and not thymine. B. Unlike DNA, RNA can fold into complex shapes O C. Unlike DNA, RNA can directly interact with proteins. D. Unlike DNA, RNA is much more reactive.

DNA and RNA are both information carrying molecules that are essential to all forms of life today. But what is the property of RNA that makes us think it was the first of these two molecules to evolve? A. Unlike DNA, RNA uses the nucleotide uracil and not thymine. B. Unlike DNA, RNA can fold into complex shapes O C. Unlike DNA, RNA can directly interact with proteins. D. Unlike DNA, RNA is much more reactive.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter18: Life's Origin And Early Evolution

Section: Chapter Questions

Problem 5SA: RNA in ribosome catalyzes formation of peptide bonds in all organisms. This supports the hypothesis...

See similar textbooks

Similar questions

Which of the following correctly describes a structural feature of DNA or RNA? a. RNA may fold into complex three-dimensional structures necessary for its activity b. RNA & DNA are both usually double stranded c. DNA tends to fold into complex three-dimensional structures required for its activity d. DNA contains a pentose sugar with a hydroxyl group in the 2' position
Which of the following is a true statement concerning RNA? Group of answer choices a. mRNA is single stranded; tRNA and rRNA are double stranded b. each tRNA binds to a specific amino acid c. rRNA and mRNA last for only a short time in the cell d. tRNA contains the base thymine
The central dogma of biology describes a pattern of information flow. Which example(s) below violate the central dogma? Mark all that apply a. using the information in an RNA molecule to create a polypeptide (protein) b. using the information in an RNA molecule to create DNA c. using the information in a protein to create an RNA molecule O d. using the information in DNA to create an RNA molecule
Which of the following is incorrect? a. Amino acids may have one or more triplet codes or codons b. Translation refers to the synthesis of RNA DNA replication is possible due to the complementarity of the two strands of DNA Od. A mutated gene can cause disease O c.
What genetic material in a living cell which is single stranded involved in the coding of genes for protein synthesis? * 1 point a. DNA b. RNA C. mRNA d. tRNA
Which of the following statements about nucleic acids is not correct? Select one: A. In DNA the distance between the strands of the double helix is relatively constant. B. The growing DNA polymer is synthesized in the 5' to 3' direction. C. The enzymes that catalyze DNA synthesis are known as DNA polymerases. D. RNA strands are synthesized in the 3' to 5' direction. E. Unlike DNA, RNA is easily cleaved because the 2'-OH group of the ribose is a nucleophile that catalyzes hydrolysis of the strand.
A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this TRNA? O A. The tRNA will not bind to this codon. O B. Translation stops and the protein is released. O Č. The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome. vered MacBook Air 80 F3 D00 D00 F4 F2 F5 % & 23
Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand be? 5’ ATAGATGAAGCCCCACGCCTA 3’ (coding strand of DNA) 3’ 5’ (template strand or non-coding strand of DNA) 5’ 3’ (mRNA strand) a. UAUCUA b. GCGAGT c. TATCTA
RNA molecules differ from DNA molecules in that they * a. are single stranded rather double stranded b. contain five different bases rather than four c. contain a greater number of nucleotide units d. no correct response Which of the following is definitely an incorrect codon-amino acid pairing? * UUU-UUC and Phe-Phe ACU-AAU and Thr-Asn GCC-GCC and Ala-Gly ACU-GUA and Val-Pro Which of the following statements concerning codons is incorrect? * a. they are found within mRNA molecules b. they specify base sequence in terms of four-nucleotide units c. there are 64 of them d. no correct response
Which type of RNA carries activated amino acids to the ribosome for assembly into proteins? A. mRNA. B. sRNA. C. tRNA. D. rRNA. Strands in the stem of stem-loop RNA structures are parallel. True Falsein bold is my answer but im not sure the second one i need help with it too
A frameshift mutation occurs in a DNA strand. The mutation is a deletion of the two nucleotides indicated in the sequence below. 1. Rewrite the mutated DNA sequence. 2. Transcribe the given template strand of dna. 3. Translate the mRNA sequence.
.2