Diversity in the healthcare field is an ongoing concern for many reasons: language barriers, religious beliefs cultural differences, personal preferences, etc. Although diversity and cultural training exists for healthcare workers, many people believe that more still needs to be done to offset the concerns to improve the overal standard of care for everyone. Watch the video: Cultural Competence for Healthcare Providers Answer the questions below: 1. What was the patient in the video complaining about? 2. What did the doctor and nurse in the video do to help understand the patient's needs? 3. In your own words, how would you define "cultural competence"? Please provide depth and insight into this question 4. Explain what you would do to improve diversity training in the health care field. Please provide specific examples with your explanation.

Diversity in the healthcare field is an ongoing concern for many reasons: language barriers, religious beliefs cultural differences, personal preferences, etc. Although diversity and cultural training exists for healthcare workers, many people believe that more still needs to be done to offset the concerns to improve the overal standard of care for everyone. Watch the video: Cultural Competence for Healthcare Providers Answer the questions below: 1. What was the patient in the video complaining about? 2. What did the doctor and nurse in the video do to help understand the patient's needs? 3. In your own words, how would you define "cultural competence"? Please provide depth and insight into this question 4. Explain what you would do to improve diversity training in the health care field. Please provide specific examples with your explanation.

Social Psychology (10th Edition)

10th Edition

ISBN:9780134641287

Author:Elliot Aronson, Timothy D. Wilson, Robin M. Akert, Samuel R. Sommers

Publisher:Elliot Aronson, Timothy D. Wilson, Robin M. Akert, Samuel R. Sommers

Chapter1: Introducing Social Psychology

Section: Chapter Questions

Problem 1RQ1

See similar textbooks

Related questions

Q: Question 6 of 24 The nurse is observing a student nurse perform a peripheral assessment on the…

A: Peripheral assessment is done to identify disorders of the PVS (peripheral vascular system) and is…

Q: Use the survivorship curve graph to answer questions 19-20. (Extra Credit!) 100 A 10 0.1 100 50…

A: As per our guidelines we are supposed to answer only ? One question ( if there are multiple…

Q: Alpha wave QRS complex T wave P wave ST segment Copyright McGraw-Hill Education. Permission required…

A: An electrocardiogram is done to check the rhythm of the heart as well as the electrical activity. It…

Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…

A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…

Q: * Regaldíng Medicolegal importnce af stab wound A ysually homicidal in origen P Multiple and on…

A: Regarding medicoleagal importance of stab wound:- A) statement is correct As, most of the stab…

Q: Label the internal structure to which the lines are pointing to

A: -The human heart is the four-chambered muscular organ, formed and sized roughly like man's closed…

Q: Hi, I need help labeling this

A: Skeletal muscles are muscle tissue attached to the body's bones. The skeletal muscle is made up of…

Q: Chapter 1 Put the scientist's NAME in the correct area for their accomplishments; no more than 3…

A: the answer is given below:

Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…

A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…

Q: Ever since we transitioned online, we have not received help. Can you be of assistance? It would be…

A: the genotypic ratio indicates the ratio of the segregation of gametes into distinct genetic makeup…

Q: ㅁ -1

A: A flower is a part of a plant classified as an angiosperm. Angiosperms are plants that produce…

Q: Font Paragraph Drawing Editing 1. How many chromosomes? 2. Describe the abnormal chromosome 3. What…

A: Mutation is a process by which the genetic material (DNA) of an organism is altered. It can be a…

Q: Anole species in the Greater Antilles have been sorted into six ecomorphs. Species within each…

A: Ecomorph Ecomorph are the species that have similar structural habitat or niche. These species are…

Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…

A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…

Q: Question 2- Notes G Line Guide Reset Answer Use the information below to answer the question. Com…

A: All the plants are able to fix atmospheric carbon dioxide into their biomass by the process of…

Q: 1. Larry Martin and David Burnham (U of Kansas) made their 3-D model of microraptor from a mold of a…

A: Microraptors are small, four-winged dinosaurs. They contain 2 pairs of feathers one in the for limbs…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription Translation During…

Q: CH OH CH -Q OH HHHHHHHHH CH CH C-C-C-C-C-C-C-C-C-C-H HO H. HHHHHHHHH CH-CH OH H. H. OH OH H

A: Biomolecules are substances that are present in living beings. The biomolecules are formed of…

Q: 4) The nurse assesses the patient's medicalhistory and notes that she has not received routine…

A: Routine medical screening and treatment Screening test helps to detect potential health issues, and…

Q: Peppered moths

A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity…

Question

https://youtu.be/dNLtAj0wy6I I attached the link also that they said plz only minnimum 250 words plz

Diversity in the healthcare field is an ongoing concern for many reasons: language barriers, religious beliefs,
cultural differences, personal preferences, etc. Although diversity and cultural training exists for healthcare
workers, many people believe that more still needs to be done to offset the concerns to improve the overall
standard of care for everyone.
Watch the video:
Cultural Competence for Healthcare Providers
Answer the questions below:
1. What was the patient in the video complaining about?
2. What did the doctor and nurse in the video do to help understand the patient's needs?
3. In your own words, how would you define "cultural competence"? Please provide depth and insight into
this question
4. Explain what you would do to improve diversity training in the health care field. Please provide specific
examples with your explanation.*
Word minimum for this assignment - 250 words

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Embracing different cultures lead to harmony in the society

VIEW

Step 2: Cultural competence

VIEW

Step 3: Strategies to improve diversity in healthcare training

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

hi can you please help me review this vedio including vedio topic presented, the information provided the politics and the knowledege learned. Bioterror – https://www.youtube.com/watch?v=hgPUkgZ4C3s Brain Eater https://www.youtube.com/watch?v=OQ7uq04fEjs
Online Slides x O Copy of LAB 12 Investigation: Mi x E 4.5.3 - Google Docs SMmahtkxDnuy9mVIOYRXYMy2hoeQW_wnAmFf365-QV8/edit#slide%-id.g9f123b567f_0_45 O Slideshow ge Tools Add-ons Help Accessibility Last edit was seconds ago Background Layout- Theme Transition 8 9. 1. t 2 1 3 lL 4 5 6 I 7 9. What is the longest phase of the cell cycle. Suggest a reason for this to be the case. 10. Are the other phases of mitosis equal (or close)? Suggest a reason for any differences in the timing of mitosis phases. 11. You were asked in the beginning to suggest which phase would be the most difficult. Now that you've viewed cells in mitosis, what did you find difficult about completing the table on the previous slide? aker notes
You have to do the ii part(ii) only that i attached the picture second The three links in the start (before part i) i am going to attach below have a look and plz solve part number 2 https://www.hopkinsallchildrens.org/Patients-Families/Health-Library/HealthDocNew/5-Myths-About-STDs https://phelpshealth.org/news/featured-stories/dispelling-myths-about-sexually-transmitted-diseases-stds https://www.cdc.gov/std/default.htm
Suffix u Build the Medical Term Combining Vowel niteb roseo mot isibom foooo bli noT beboen ei eno Jewov.gninidmoo.a bbA .beblvarg olde Root Word Definition sigmoid 8. new surgical opening in the sigmoid colon 9. surgical removal of the thymus gland thym dermat 10. specialist in the study and treatment of the skin arthr 11. instrument used to observe the joints 12. weakness of the muscle my 13. disease of the bone oste 14. record or image of the spinal cord myel 15. new (surgical) opening in the trachea trache Forming Plurals Directions: For each medical term, choose the en plural form. Then supply the correct plural form fo ed to produce the n. a ae ata d bliu8 meT IsolboM ces es ge bioWto es ies 1. diagnosis noi 2. vertebra 3. аppendix 4. stigma ol gi 5. spermatoz 6. sinus 7. thorax
Convert a patient's weight from 67 kilograms to pounds using dimensional analysis. Record the lb answer using one decimal place.
https://assignment.itslea https://assignment.itslear x 9 https://assignment.itslear x PDF Reader- View, Ec signment.itslearning.com/mvc/Attachment/Get?Fileld%-DM4lwUXm6r06na1JFB4B7TvjP7UpLpDF%2f%2bbc8wkWTVJCCC %2f e Unit_Practice Problems and Homework_Incomplete Do... Saved to itslearning v P Search (Alt + Q) Layout References Review View Help O Editing Roman 12 A A A EEEE AaBbCc AaBbCc AaBbCc No Spacing ab x, x Aa A Normal Heading 1 Ec Paragraph Styles Font A cattle breeder knows that the hornless condition (H) is dominant over horned (h). He mates a heterozygous hornless cow who is roan colored with a horned roan bull. What types of offspring would be expected from this cross? Give the probability of each. 6.