Disscuss in details the contribution of morgan and sturtevent in the area of genetics.

Q: DNA is a chemical that cells use to store information. Describe how information is encoded in DNA,…

A: DNA is Deoxyribo Nucleic Acid which is a complex molecule which consists of two polynucleotide…

Q: Describe Redi’s work and why it was important.

A: Francesco Redi is known as the “founder of experimental biology” and also as the “father of modern…

Q: Briefly mention the contribution of T.H. Morgan in genetics.

A: An American evolutionary biologist, geneticist and embryologist, Thomas Hunt Morgan was a great…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" =  5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: 2. Corn is a flowering plant whose somatic chromosome number is 20. How many of each of the…

A: Introduction Mitosis is a nuclear division process that occurs in eukaryotic cells when a parent…

Q: Below question 15 is the original DNA molecule. Delete (remove) the underlined letter. 14. What term…

A: DNA stands for deocyribonucleic acid. It is negatively charged molecule residing in the nucleus. It…

Q: Briefly explain the contribution that James Watson  made to the study of genetics

A: James Watson, an American molecular biologist, a geneticist and a zoologist. The full name of James…

Q: Which of the following is true about a merozygote? conjugation with an Hfr donor will never produce…

A: Merozygote is a state of a bacterial cell being temporarily partial diploid as a result of the DNA…

Q: Write a short essay that explains how recombinant DNA techniques were used to identify and study…

A: DNA segment carrying information from parents to the offspring is called a gene. It is a determinant…

Q: Read the images given before answering the question below. Identify the two common diseases that…

A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…

Q: Choose the best options, by dragging and dropping the colour coded text boxes below, that fill in…

A: Operon is transcription unit of prokaryotic genome with consist of many contiguous structural genes…

Q: Which title best describes the research paper? O A. Effects of Substance A and B to the growth of…

A: These are multiple choice questions.

Q: Which is an application of genetic engineering

A: Genetic engineering permits researchers to move desired genes from one plant or creature into…

Q: Briefly explain the contribution that Kary Mullis made to the study of genetics

A: Kary Mullis was an American biochemist. He was born in north Carolina on 28 December, 1944. He…

Q: ntroduction to a report on the extraction of DNA using the technique of salting out method.

A: DNA molecule is the larger molecule that consists of a chain of nucleotides which was organized in…

Q: Briefly explain the contribution that August Weismann made to the study of genetics

A: Genetics is the branch of Biology dealing with the study of genes including their structure,…

Q: Whose work contributed to the discovery of the structure of DNA? a. James Watson b. Francis Crick…

A: In 1953, James Watson and Francis Crick published their study of DNA structure in Nature. Many…

Q: Albinism occurs in the United States at a frequency of 1 in every 160,000 live births. Assume that…

A: Albinism is an autosomal recessive disorder characterised by pigmentation of the skin, eyes, and…

Q: coding strand A mutated sequence of DNA CA C GA AT TAGAT GG 5' 3, 5' C T AT GT G C T TA ATC TAC C…

A: Coding strand of DNA:- The DNA strand present in the direction of 5' to 3' acts as coding strand.…

Q: A technology called PCR is used for replicating large quantities of DNA in forensic science (Chapter…

A: Introduction  PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…

Q: Red-green color blindness is an X-linked recessive trait in humnans. Consider an affected woman and…

A: Red green color blindness is a recessive X- linked recessive trait in humans. It is given that an…

Q: DNA RNA Type of sugar Number of strands Nitrogenous bases Location Function Helix (Yes or No)…

A: DNA and RNA are called nucleic acids which are made up of the basic units called nucleotides. A…

Q: Assess the yield, concentration, and purity of the DNA extract of shrimp based on given data.

A: DNA yield and purity is determined by the measurement of absorbance which is the most common…

Q: Using suitable illustrations describe a method to sequence a fragment of DNA and include how the…

A: DNA sequencing is the process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…

Q: Name the scientist who developed a DNA sequencing technique. Understand the sequencing technique

A: The method of determining the order of nucleotides that are adenine, thymine, cytosine, and guanine…

Q: is slowed down due to oxaloacetate being diverted to for citric acid cycle, gluconeogenesis citric…

A: The degradation of large molecules into smaller ones is called catabolism and the synthesis of large…

Q: Mitichondrial DNA is a kind of DNA that is found in the cells of mitochondri Provide a succinct…

A: Yes, mitochondrial DNA is a kind of DNA found in the mitochondria. It is different from the DNA…

Q: Which of the following statements best explains the mechanism for DNA replication? DNA replication…

A: Ans-DNA replication is semi-conservative, because each DNA strand serves as a template during…

Q: Choose and describe a scientific technique or practice related to genetics and eugenics. Provide the…

A: The chromosomes are made up of DNA (deoxyribonucleic acid) molecules that carry genetic information.…

Q: Which mutation would be harmful to the farming industry

A: Any alteration in the sequence of DNA, the complex molecule that codes for life, is referred to as a…

Q: Describe the functions of various enzymes involved in DNA replication.

A: DNA replication is the process by which one DNA molecules produces two identical copies of itself.…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.