Q: what scale of study would you study as an Community ecology
A: Introduction Ecology is a branch of science which deals with the study of the relationship between…
Q: 23. If a fly acclimated more slowly than the change in air temperature, it would pay an opportunity…
A: Adaptation is needed for living organisms to survive. An adaptation is a characteristic that allows…
Q: Can you send me the website or where you got this information so I can read further please
A: Photosynthesis and cellular respiration are two of the vital biochemical processes that are…
Q: Many people of Asian ancestry have alcohol dehydrogenase enzymes that are far more efficient than…
A: We know that Alcohol (Ethanol) gets converted into acetaldehyde with the help of enzyme alcohol…
Q: How does intron splicing work? Draw the mechanism. Label the branchpoint and lariat structures.
A: Introns are the non-coding regions of a DNA or an RNA sequence, whereas, the exons are the coding…
Q: List four (4) government agencies and industry organization that can provide accurate and reliable…
A: We obtain fuel for our bodies through eating and getting enough nourishment. Every day, we must…
Q: Which of the following would be considered "extreme" environmental conditions for microbes? a) pH of…
A: Introduction Extremophiles are microorganisms that grow well in extreme environments, which humans…
Q: Dissect the blood supply to the heart; open each of the four chambers and learn their internal…
A: An organ, of the size of the fist, the heart circulates blood allthrough your body. It serves as…
Q: When a movement occurs, which of the following brain areas is the last one to reach its peak of…
A: The voluntary movements of the body involve the motor cortex and the associated cortex region. The…
Q: Instructions: This is a take-home problem to help you practice recent material, and you are welcome…
A: Introduction:- Transcription is the process of synthesis of RNA molecules ( coding as well as non…
Q: 11 MULTIPLE CHOICE QUESTION If proteins are not the right shape
A: 3- they usually won't work properly If proteins are not the right shape they usually won't work…
Q: Your cousin is embracing a sugar-free lifestyle and has made sugar-free jam. Canned food that is low…
A: Clostridium is a genus of bacteria that can cause a variety of diseases, including tetanus,…
Q: If a cell that takes up ½ of the field of view (field diameter of 1 mm) and is 20 ocular divisions…
A: A cell is the basic structural and functional unit of life. Cells are the building blocks of all…
Q: [6.5] In the space below, briefly explain why the average times for the two CO₂ molecules you…
A: Regarding gases, a number of fundamental presumptions have been established (through…
Q: 2. Howler Monkeys - National Geographic: https://www.youtube.com/watch?v=REPoVfN-Ij4 Questions:…
A: Howler monkeys are the largest group among the new world monkeys.These monkeys are famous for loud…
Q: Which of the following statements related to the Calvin Cycle is CORRECT? Six molecules of G3P are…
A: Calvin cycle is the part of photosynthetic reactions, where carbon is fixed into sugar. This…
Q: Provide a explantion and diagram of the Intracellular mechanism of smooth muscle relaxation via…
A: Introduction: Our body have different kinds of nervous system such as central nervous system…
Q: ㅁㅇ PTO 어어어어어어어 In the pedigree shown, indicate whether each of the following inheritance patterns is…
A: Some genetic abnormalities have an inheritance pattern known as autosomal recessive. A gene is…
Q: Determine the process by which the small RNA species identified by CDNA sequencing is considered as…
A: Transcriptome sequencing is used to identify the regulating small ribonucleic acids (SRNAs)…
Q: You answered this question like this??? I can’t read the answers , all answers are cut-out please…
A: Mechanisms of reproductive isolation are a collection of behavioural patterns, physiological…
Q: How we can formulate nicotine chewing gum? Please answer at your own easy words.
A: Nicotine is a naturally produced alkaloid in the nightshade family of plants and is widely used…
Q: g. Give the official compounds used for treating diarrhea. (Gastrointestinal Agents) h. Name some…
A: Diarrhea is the unusual frequency of water or loose stool. This is usually frequent bowel movements…
Q: 2) The intermediate disturbance hypothesis proposes that __________. A. the highest diversity in…
A: Introduction: The number of various species present in an environment and the relative abundance of…
Q: A subject who is at 0-95ATM (211-02) has an arterial O₂ concentration of 19ml/dL and and arterial…
A: Oxygenation of tissues is crucial for maintaining the metabolic process that occurs in each and…
Q: All of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the…
A: tRNA is a type of RNA molecule that helps to decode a gene's information in order to produce a…
Q: Q1.11. What is an ecological community? A group of individuals from a given species that interact A…
A: A subfield of research called ecology includes the fields of human science, demographic, population,…
Q: Why is there a distinction of c2c12 cells with and without insulin?
A: The myoblast cell line C2C12 has been extensively used in vitro as an examination model to…
Q: Some potentially pathogenic bacteria and fungi, including strains of Enterococcus, Staphylococcus,…
A: Because germs spread from hands to garments and other locations, hospital staff members should…
Q: What is the correlation between the Gram reaction and growth on EMB and MSA plates?
A: Introduction Gram staining is a process by which we can differentiate between gram positive and gram…
Q: 11. During sexual reproduction, the population is more likely to evolve by genetic drift. O True O…
A: Introduction:- Reproduction is the process by which offsprings are produced. Reproduction is of two…
Q: Your lab partner set up plate 4 by spreading a pure culture of E. coli onto the plate and addind…
A: Escherichia coli, more commonly known as E. coli, is a type of bacteria that is commonly found in…
Q: How does staining procedure relates to the benefit endospores provide to cells?
A: Endospore Staining-The main purpose of endospore staining is to differentiate bacterial spores from…
Q: Forked bristles, miniature wings, and sable bodies are all homozygous recessive traits whose genes…
A: In genetics when two to three genes are present I the same chromosomes, it is termed as linked…
Q: 1. What cell division event is depicted above? (be as specific as possible) 2. What type of protein…
A: Cell division results in partition of genetic material into the daughter cells. During mitosis cell…
Q: For each of the following sets of traits and descriptors, give the name of the most specific primate…
A: Primates include eutherian mammals that are terrestrial mammals. They have larger brains, visual…
Q: An insulin-dependent diabetic patient calls the office complaining of sudden onset of nausea. Upon…
A: Diabetes type 1 is a chronic illness also referred to as juvenile diabetes or insulin-dependent…
Q: Which of the following best supports the endosymbiotic theory of the evolutionary origin of…
A: Except for chloroplasts, mitochondria don't seem to have a common ancestor with any other organelle.…
Q: Gaucher disease is an early onset rare autosomal recessively inherited lysosomal storage disorder…
A: Given: Gaucher disease is an autosomal recessively inherited lysosomal storage disorder (LSD). An…
Q: 2. Explain how the problem of antibiotic resistance presents an example of evolution
A: Antibiotic resistance is a significant subtype of antimicrobial resistance (AMR) that pertains…
Q: 13. A population of whiptails would adapt to environmental change faster if all reproduction were…
A: The number of individuals present in a particular area represent population. The reproduction is…
Q: a) Viruses can have DNA or RNA genes b) Antibiotics can kill bacteria, viruses and fungi c)…
A: INTRODUCTION Answers of a to l is given below.
Q: 1. For each scenario, analyze the validity and reliability (determine if it is high or low). Explain…
A: Given:- Reliability stands for the consistancy of measure if the result should be…
Q: 3. The narrow sense heritability of withers height in a population of quarter horses is 17%. The…
A: The narrow sense heritability of the hand's height of a horse population was given at 17%. The…
Q: talk about darwins journey in Falkland island, don't forget to talk about the tools that he used if…
A: Sir Charles Robert Darwin formulated the Theory of Evolution by Natural Selection, based on his…
Q: Anterior spread of cancer of the supravaginal part of the cervix will first involve which of the…
A: The supravaginal portion is separated from the bladder by a tissue parametria, which elongates on to…
Q: Which of the following structural features of the DAPI molecule explain its binding to DNA at…
A: Introduction:- DNA acts as the genetic material and present inside the nucleus of a cell which is…
Q: changes sensitization and classical conditioning? presynaptic level that are between What is…
A: The learning is classified into two : non-associative learning and associative learning, this was…
Q: 22. On a cold night, more flexible cell membranes will function better than less flexible ones. True…
A: Introduction:- Cell membrane is present as the outermost covering of a cell. It is made up of lipids…
Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…
Discuss the human impacts on aquatic ecosystems
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Describe what happens to an ecosystem when a keystone species is removed.Describe the potential effects when a keystone species is removed from a community.The process whereby oxygen is depleted by the growth of microorganisms due to excess nutrients in aquatic systems is called _________. a. dead zoning b. eutrophication c. retrophication d. depletion
