discrete strucrtures question Let F(x.y): "x is friend with y", N(x): "x is funny", W(x): "x is wise",R(x): "x is fair". The domain for x and y is the set of all persons.Select the symbolic (s) of the following sentence:"All not fair persons are friends with all funny persons"None of all the proosed answersO vxVy ¬R(x) ^ N(y)→F(x,y)O 3x Vy R(x) v ¬N(y) →F(x,y)VxVy ¬F(x,y)→R(x) v ¬N(y)O vx Vy (R(x) v ¬N(y)) v F(x,y)

Answered: discrete strucrtures questi

Engineering

Computer Science

discrete strucrtures questi

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: Using the KNearest code modify it to use the features temperature, luminosity, and absolute…

A: Load the data into the program. Create three separate lists, one for each feature (temperature,…

Q: Draw 10 non-overlapping “right” stars of the same size without taking hand from paper. (Do not copy…

Q: no code is needed this is a hand written question Question: You are given the following…

A: Bilinear interpolation of first order is done by finding linear interpolation of adjacent pixels.…

Q: please help with python program I am providng program that some part u can reuse for question nubmer…

A: Answer: Here is the solution to the above problem: - The scatter plot is given by We run…

Q: body { background-color:rgb(207, 201, 186); color:rgb(26, 12, 2); margin: 15px; padding:…

A: This text provides a list of CSS rules for adjusting the layout of a webpage. The first rule centers…

Q: __________ is the image’s width to height ratio. a. Aspect ratio b. Size ratio c. Projection ratio…

A: ANS: - Option(a) is correct. Aspect ratio is the image's width to height ratio.

Q: wsite a Mattab code to perform convolution of 4 Ko unit step functions

A: Write a MATLAB program to perform convolution of two unit-step functions. Solution : Define two…

Q: declaration to the existing h1 rule. Note that because this value has all double digits, you can use…

A: Answer 4: make h1 heading purple: h1 { color: #993399;font: bold 1.5em Georgia, serif;text-shadow:…

Q: Using Python The Koch snowflake is a fractal shape. At level 0, the shape is an equilateral…

A: Given: Using Python The Koch snowflake is a fractal shape. At level 0, the shape is an equilateral…

Q: Python Turtle Graphics

A: from turtle import *from shapes import *from random import randint myPen =…

Q: Identify the format element which is used to display a three-letter abbreviation day of the week O a…

A: The various format are year,yyyy,yy = Year month,mm,m = month

Q: Really long pipelines could be great: if we split the instructions into 100 smaller chunks we could…

A: Pipelines help increase the efficiency of computer architectures by reducing their clock frequency,…

Q: I need the Form Design for the Solar Panel Installation

A: Below is the complete solution with explanation in detail for the given question about the form…

Q: KNearest code modify it to use the features temperature, luminosity, and absolute magnitude to…

A: To modify the KNearest code to use the features temperature, luminosity, and absolute magnitude to…

Q: What distinguishes monospaced and proportionally spaced typefaces?

A: Monospaced typefaces, or fixed-pitch otherwise non-proportional fonts, contain equal spacing for…

Q: What's the difference between a monospaced typeface and one that's proportionally spaced?

A: The answer is given below.

Question

discrete strucrtures question

Let F(x.y): "x is friend with y", N(x): "x is funny", W(x): "x is wise",
R(x): "x is fair". The domain for x and y is the set of all persons.
Select the symbolic (s) of the following sentence:
"All not fair persons are friends with all funny persons"
None of all the proosed answers
O vxVy ¬R(x) ^ N(y)→F(x,y)
O 3x Vy R(x) v ¬N(y) →F(x,y)
VxVy ¬F(x,y)→R(x) v ¬N(y)
O vx Vy (R(x) v ¬N(y)) v F(x,y)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

please answer correctly and explain all choices from a, b, c and d
please help with python program I am providng program that some part u can reuse for question nubmer 2 is attched in image # call the appropriate libraries import numpy as np from numpy import mean from numpy import std from numpy.random import randn from numpy.random import seed from matplotlib import pyplot from numpy import cov from scipy.stats import pearsonr from scipy.stats import spearmanr import scipy.stats as stats import pandas as pd # generate data # seed random number generator seed(1) # prepare data data1 = 20 * randn(1000) + 100 data2 = data1 + (10 * randn(1000) + 50) # print mean and std print('data1: mean=%.3f stdv=%.3f' % (mean(data1), std(data1))) print('data2: mean=%.3f stdv=%.3f' % (mean(data2), std(data2))) # plot the sample data pyplot.scatter(data1, data2) pyplot.show() # calculate covariance covariance = cov(data1, data2) print('The covariance matrix') print(covariance) # calculate Pearson's correlation corr, _ = pearsonr(data1, data2) print('Pearsons…
Can anyone please help to create a logic diagram based on the equation K0 = A’ ? ( This question is not a part of any graded assignment)
question in the image
The Koch snowflake is a fractal shape. At level 0, the shape is an equilateral triangle. At level 1, each line segment is split into four equal parts, producing an equilateral bump in the middle of each segment. Figure 7-15 shows these shapes at levels 0, 1, and 2. Figure 7-15 First three levels of a Koch snowflake At the top level, the script uses a function drawFractalLine to draw three fractal lines. Each line is specified by a given distance, direction (angle), and level: The initial angles are 0, -120, and 120 degrees. The initial distance can be any size, such as 200 pixels. If the level is 0, then t Python GUI TestIncomplete Program generates the correct image
Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…
Scaling by a fraction move the point closer to the origin True or false