d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide RNA primer 2. a 2-nucleotide Okazaki fragment
Q: A biologist gathered data to show the interaction of the golden-cheeked warbler and juniper tree…
A: It is given that the bar colored in light grey gives the number of juniper tree person acre and the…
Q: An inversion heterozygote has the following inverted chromosome: Centromere A B CD JI HGF E¸ KL M…
A: There are kinds of inversion, paracentric and pericentric, with the distinction being whether or…
Q: URGENT. PLZ HELP.
A: Arginine is an important amino acid that makes up the protein. The protein is made up of a sequence…
Q: 6 9 A nurse caring for a client who has potassium level 5.4 meq/L. the nurse should assess the…
A: Answer. Potassium is an essential mineral needed by body. Potassium carries a small electrical…
Q: 18) What is the phenotype ratio in the B1 generation that resulted from crossing AB/ab x aa/bb? You…
A: Phenotype refers to the visible traits or physical traits of an organism like height, colour of eye,…
Q: I don't get it. I need help to explain to me
A: Mutation can be classified as small -scale or large- scale. In the concerned mutational phenomenon,…
Q: Which of the following are benefits of movement corridors? (choose all that apply) They may…
A: Introduction Animals Use Movement Corridors To Travel From One Habitat To Another. They Are Long,…
Q: 1. Which of the following is true of a maternal effect? A) The gene is located in the nucleus. B) It…
A: Maternal effect produces when specific phenotypes of offspring are controlled by the factors that…
Q: ACTIVITY 3. POINT MUTATION Directions: Translate the genes in the TRNA into amino acids. Then,…
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: Phosphofructokinase (PFK) activity is altered by changes in the energy state of the cell. Under high…
A: Phosphofructokinase (PFK) is an enzyme of the glycolytic pathway. Glycolysis is a catabolic pathway…
Q: E. coli BL21 cells carrying a pQE expression vector can be induced to produce large amounts of a…
A: Ans is f - glucose, E. coli BL21 Cells carrying a PQE expression vector can be induced by adding…
Q: Please Drag and Drop the APPROPRIATE label to the HPT axis. TRH TSH Thyroid Hormone (T3, T4) HPT…
A: Endocrine glands are ductless glands that secrete hormones directly into the blood. Hormones are…
Q: Of the choices below, the best definition of evolutionary fitness is: Ostrength the ability to adapt…
A: In the ecosystem different species interact with each other and also the individuals with same…
Q: L L 01:20:06 When a person is sick with a bacterial infection, doctors often prescribe antibiotics…
A: Bacteria or other pathogens develop resistance to the drugs. This helps them to survive despite much…
Q: Substrates typically bind to enzymes via
A: Enzymes are made up of amino acids and residues having side chains. They are globular proteins.…
Q: Cheatgrass is an annual grass plant native to Eurasia that was unintentionally introduced into the…
A: Introduction: A population is all the organisms of the same group or species, which live in a…
Q: Please match the appropriate attributes for the two hormones provided (Estrogen and ADH) Hormone…
A:
Q: Which procedure should have been performed to prevent error in this investigation?
A: The correct answer is d, Both groups should have been tested in the same soil type at each humidity…
Q: In the following reaction, a molecule of ATP bound to the enzyme transfer a phosphate to fructose…
A: Correct Option: b. The change in the activation energy barrier is greater than 27.6…
Q: A dwarf mouse is heterozygous at the Igf2 locus (one Igf2 allele, one Igf2 allele) and has 50% dwarf…
A: A genetic disorder or trait can be passed down from parent to child through gene mutations (changes)…
Q: In hepatocytes, glucagon ilin inden release of select one, which leads to the activation of PKA. One…
A: Hepatocytes are responsible for regulating blood glucose level. When the blood glucose level…
Q: Skeletal System: Posterior View 7. 8. 9. 10. 11. 12. 1. 2. 14. 15. 16. 17. 23. 24, 25. 26. 27. 18.…
A: The skeletal system in human body is made up of 206 individual bones. The skeleton system is divided…
Q: Which of the following representations most closely resembles an ecosystem? O A group of house cats…
A: Introduction The Ecosystem Is The Structural And Functional Unit Of Ecology In Which Living…
Q: Suppose an X-linked gene in mice exists as two alleles, B and b. X-chromosome inactivation, a…
A: Northern blotting is a technique in the molecular biology to study the gene expression. It is used…
Q: 8. Of the following molecular events, which is the most critical for phenotypic expression? a. the…
A: Introduction :- Molecular biology involves many kind of molecular events that takes place inside the…
Q: Help please let me answer
A: We know that Lymphatic vessels are a network of capillaries and a huge network of tubes that move…
Q: Select the functions of blood. It produces hormones that coordinate body activities. It generates…
A: Blood: Blood is a bodily fluid found in humans and other animals that transfers metabolic waste…
Q: 22. Of the 5 senses, which is the only one without definable receptor cells? O smell O hearing O…
A: Sensory receptors perform endless functions in our bodies. For example, During vision the receptor…
Q: Multiple answers questions. SELECT ALL THAT APPLY. Which of the following are ORGANIC components of…
A: As we know Bone is the living tissue that makes the skeleton of the human body. Bones provide and…
Q: a. D. sodium dodecyl s BugBuster
A:
Q: 2', 3'-Dideoxyinosine has been approved as an anti-HIV drug. Propose a mechanism by which it might…
A: The management of HIV/AIDS normally includes the use of multiple antiretroviral drugs in an attempt…
Q: Click on the transport vesicle produced by the rough ER carrying enzymes and proteins to the Golgi…
A: Transport vesicles contains proteins which are COPII-coated that leave endoplasmic reticulum. It is…
Q: 5. Using the information from mutation analysis, sequence analysis and gene expression analysis,…
A: Arabidopsis is a small plant of the Brassicaceae family, These plants are closely related to cabbage…
Q: Which of these statements will corroborate (confirm) known information pertaining to alleles? OA In…
A: When the dominant allele of one gene hides the expression of all alleles of another gene, this is…
Q: DNA Basics nucleotides DNA is a long molecule that caries information. It is made up of small units…
A: The genetic material present in the nucleus of a cell is known as DNA(deoxyribonucleic acid). The…
Q: Which scenarios are examples of reproductive barriers between closely related species that can cause…
A: Reproductive barriers are also known as reproductive isolation or mechanism. Reproductive barriers…
Q: 3. The fruit fly species, Drosophila biarmipes, gained its spots by a mutation in a single gene. a)…
A: Disclaimer: due to time constraints we will be answering your first 2 questions here , please ask…
Q: Epinephrine signaling activates PKA, which leads to phosphorylation of pyruvate kinase in liver…
A: The glucose level in blood is regulated by two hormones: glucagon which increases the level of…
Q: An older female patient comes in with facial weakness. She stated she has trouble chewing,…
A: Thank you for the question Answer :- The condition is called as myasthenia Gravis. In this…
Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…
A: Water It is the most important material on the planet eart. Water makes life possible as almost…
Q: From the enzymatic data below, estimate he Vmax and Km for the enzyme presenting these dat Vo nM/s…
A: Introduction Maximal Velocity (Vmax): Increasing the substrate concentration indefinitely doesn't…
Q: 7. An inversion heterozygote has the following inverted chromosome: Centromere A B JI HGF ED…
A: Crossing over is an event in cell division where two parental chromosomes come close and synapses…
Q: Assume that a population of mythical unicorns is initially in Hardy-Weinberg equilibrium. The allele…
A: The Hardy-Weinberg principle asserts that if a population is not susceptible to genetic drift, gene…
Q: 2. In the exotic leafhopper, Buggus imaginarius, 3 X-linked genes have been identified: the…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: What charge does a protein molecule have? O neutral O positive O negative O The charge depends on…
A: Diffusion and osmosis are 2 processes that depict the movement of substances from higher…
Q: Which amino acids can the amino acid D interact with via electrostatic or ionic bonds at pH 7? а. С,…
A: The amino acids are colourless, nonvolatile, crystalline solids, melting and decomposing at…
Q: Why did we inoculate the KIA slant by stabbing it with an inoculating needle rather than spread the…
A: Inoculating needles are used to inoculate microorganism like - Bacteria from one solid culture media…
Q: Which of the following types of interactions best describes the binding of MDH-His to the affinity…
A: f -The binding of MDH -His to the affinity of chromatography resin is through ionic interaction.
Please please please. Help me answer letter d and e please. Thank you so muchhh
Step by step
Solved in 2 steps
- 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene product. 3' TAC GAA ATA ACA GTA CGA CCA AAA CTT TAC ACT S 2. Assume the following nucleotide changes in the DNA strand above and write down the amino acid sequences. a. Insert thymine after position 10 of the base. b. Delete base number 9. c. Replace position 18 with guanine. d. Replace the 10th to 12h nucleotides with TAG. e. Replace the 3d to 5th nucleotides with ATT. Guide Questions2 Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA 5' a. What would be the first 5 bases at the 3' end of the complementary strand? а. b. What would be the first 10 bases at the 5' of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and with respect to the C-G base pair? d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide RNA primer 2. a 2-nucleotide Okazaki fragment5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
- 5. Design a 10-bp primer that could be used to amplify the following sequence of DNA: 5'-AGTCGATCCCTGATCGTACGCTACGGTAACGT-3'5.If the following two primers 3'AAG5' S'CCG3' were used to facilitate the polymerase chain reaction with the DNA sequence shown below, no amplification of the gene would occur. Explain why not. K 5 S'ATTTC- 3'ТАААG --gene- -СССТАЗ GGCATS25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
- 1. Cytosine deamination, in which cytosine is mutated to uracil, occurs spontaneously in DNA at a rate of 1 out of 107 cytosines in 24 hours. tofo NH₂ 'N cytosine deamination ----ဝိ NH spr a. If cytosine deamination occurs and DNA polymerase replicates the DNA with this altered base, what mutation would be introduced into DNA? b. Cytosine deamination is so common that DNA repair enzymes recognize uracil and replace it with cytosine. Given this information, why is it essential for DNA, the carrier of the genetic blueprint, to utilize thymine, not uracil, as a base?5. Consider the following DNA template strand:3’ GCA- AAA-CAA-ATA-GTG 5’Using the following sequence, identify:a. The base sequence in the DNA information strandb. Assuming that no introns are present, identify the codons present in the mRNA transcribed from the DNA template strandc. The anticodons in the tRNA that with interact with the mRNA codons in (b).d. The amino acids that will be carried by the tRNA (from c) moleculesIV. CENTRAL DOGMA OF MOLECULAR BIOLOGY Suppose the following base sequence was found in a 30-base polymer: 3' CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5 1. What would be the first 10 bases at the 5' end of the complementary strand? Second MRNA base Your answer UUU UCU UAU UGU Phe Tyr UGC Cys UUC UAC Ser Ucc UUA UCA UAA Stop UGA Stop Leu 2. What would be the corresponding MRNA sequence of the given UUG ucG UAG Stop UGG Trp CGU His CUU CCu CAU Cuc polymer? cc CAC Pro CAA Leu CUA Cua Arg CCA CGA Gin ccG CAG CG Your answer AAU AGU Asn AGC AUU ACU Ser AUC le ACC AAC Thr ACA AGA Lys AGG AUA AAA Arg AUG ACG AAG 3. What would be the resulting amino acid sequence? (Please use the genetic code chart above.) Please separate amino acids with "dash" (e.g.phe-leu-ile). GUU GCU GAU GGU Asp GGC GAC Ala GAA GUC GCC Gly Val GUA GGA Glu GGG GCA GUG GCG GAG Your answer First MRNA base (5 end of codon) Third MRNA base (3' end of codon)
- 2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes. Assume there are no introns. 3' AATTAGCAGATGCATGATGCAATTACTAGCATGTAAGTA 5' 5' TПААТСGTТСТАСGTACTАCGTTAATGATCGTACATTCAT 3' Based on your knowledge of open reading frames, list the amino acid sequences of the possible protein or proteins that could be produced from this DNA sequence. You may use any codon table of your liking to complete the work. a. b. Suppose there was a sister chromatid generated from the chromosome sequence shown above. What would be its DNA sequence (provide the sequence in the space below. Be sure to identify the 5' and 3'ends)?5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'-GGCAACGGTCCAGTCCAAGTTACG-3' 6. What are the amino acids coded for by this sequence of nucleotides: ATG GGA ACT CCA 7. What is the complementary messenger-RNA sequence for the DNA sequence shown below? ATC GGA CCG ATT GCC6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each? 6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA…