Create a search algorithm (I recommend a genetic algorithm) that acts as a finder of a fivecharacter String. This is inspired by Wordle, but does not act exactly like it. Instead of thehuman guessing the word with five guesses, the human will enter a five character string and thecomputer will attempt to guess it and will get five iterations to try to guess it.The only feedback given at each "guess" will be a fitness function which has access to thehuman entered String. The fitness function (which you will need to write) will return apercentage correct. This function will compare the two five character strings. If the "guess"string has a character that exists in the user entered string- it will be awarded 10%, if thecharacter is in the correct index, it will be awarded an additional 10%.

Programming language used => PYTHON I have provided PYTHON CODE along with CODE…

Create a search algorithm (I recommend a genetic algorithm) that acts as a finder of a five character String. This is inspired by Wordle, but does not act exactly like it. Instead of the human guessing the word with five guesses, the human will enter a five character string and the computer will attempt to guess it and will get five iterations to try to guess it.

Create a search algorithm (I recommend a genetic algorithm) that acts as a finder of a five character String. This is inspired by Wordle, but does not act exactly like it. Instead of the human guessing the word with five guesses, the human will enter a five character string and the computer will attempt to guess it and will get five iterations to try to guess it.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: java Given a String str, find and print the shortest words. The String will have multiple words…

A: import java.util.Scanner; public class Main{ public static void main(String[] args) { Scanner…

Q: Given a triangle with vertices A = What is the normal of this triangle, if the order of the vertices…

A: To find the normal vector of a triangle given its vertices A, B, and C in 3D space, you can use the…

Q: Children often play a memory game in which a deck of cards containing matching pairs is used.The…

A: The objective of the question is to create a program that simulates a memory game. The game involves…

Q: Write an applet that displays a drawing of two eyes in the center of its window. When the mouse…

A: import java.applet.Applet; import java.awt.Color; import java.awt.Graphics; import…

Q: Write an algorithm in java: Write a program that reads a series of daily high temperatures from the…

A: Part 1:Objective: This program receives a series of temperature values from the keyboard and…

Q: Having trouble creating the following Python program: A Magic Square is a grid with 3 rows and 3…

A: Check if the input is a valid 3x3 grid and contains all numbers from 1 to 9.Calculate the sum of the…

Q: Scrabble is a word game in which words are constructed from letter tiles, each letter tile…

A: Program Approach: Create a dictionary to store letters with their values. Find each letter value of…

Q: design a program using pseudocode and then completing the program in Python using a list.write a…

A: Answer : CODE import pygameimport random # optional for this program, but useful for random colors,…

Q: Write a python program that creates a dictionary whose values are lists of anagrams of words read…

A: According to given information:- We have to create a program that check the word available in the…

Concept explainers

Computational Systems

The computation systems can be defined as the systems that are capable of solving a problem that includes calculations either mathematical or logical, and are able to produce the result as an output. For example, a simple calculator that is given a set of numbers and operators as input and produces the result as an output can be defined as a computational system. The above example is a simple illustration only, the computational systems range from simple devices to complex devices such as the systems that control the SpaceX companies, Starlink satellites which are being quite recently seen in the skies at many places globally.

Question

Create a search algorithm (I recommend a genetic algorithm) that acts as a finder of a five
character String. This is inspired by Wordle, but does not act exactly like it. Instead of the
human guessing the word with five guesses, the human will enter a five character string and the
computer will attempt to guess it and will get five iterations to try to guess it.
The only feedback given at each "guess" will be a fitness function which has access to the
human entered String. The fitness function (which you will need to write) will return a
percentage correct. This function will compare the two five character strings. If the "guess"
string has a character that exists in the user entered string- it will be awarded 10%, if the
character is in the correct index, it will be awarded an additional 10%.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Summary

VIEW

Step 2 CODE

VIEW

Step 3 CODE SCREENSHOT

VIEW

Step 4 OUTPUT SCREENSHOT

VIEW

Step by step

Solved in 4 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

Java String objects are immutable. Select one: O True False
Python Algorithms Part 1 – Binary SearchLet's play a little game to give you an idea of how different algorithms for the same problem can have wildly different efficiencies. If I choose an integer from 1 to 16 and ask you to guess what the number is, you can keep guessing numbers until you hit on it. When you guess wrong, I tell you whether you are too high or too low. Once you've guessed the number, think about the technique you used to decide each of your next guesses.If you guessed 1, then 2, then 3, then 4, and so on, until you guessed the right number, you used an approach called “linear search,” meaning you guessed the numbers serially and sequentially, as if they were lined up in a row. This is definitely one way to find the mystery number, but it could require as many as 16 guesses. However, you could get lucky, if the number was 1, you’d only need 1 guess. Using a linear search process, on average, you'd need 8 guesses.There is an approach that is more efficient than just…
Write a program that animates the linear search algorithm. Create a list that consists of 20 distinct numbers from 1 to 20 in a random order. The elements are displayed in a histogram, as shown in Figure 10.17. You need to enter a search key in the text field. Clicking the Step button causes the program to perform one comparison in the algorithm and repaints the histogram with a bar indicating the search position. When the algorithm is finished, display a dialog box to inform the user. Clicking the Reset button creates a new random list for a new start.
Please explain the steps
Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT
JAVA PROGRAMMING LANGUAGE PLEASE. Convert the following UML to code in the image given below.
Write a program using PHYTHON to create a grocery list where the user will add items one at a time until entering the word "STOP".At that point, the program will print out the items in the grocery list, 1 item per line.
putty program for unix can can not get the screen to show the mountain list. how do i do this?
Building a histogram. Write a python program to find the number of occurrences of each word in a text file. The first part of the task is to open the file, then create a dictionary to read each word from the file and compute the word's frequency (consider words written in capital letters equal words written in lower case). At the end build two lists, one with each word in the file (call it words_list) and a second list with the number of occurrences of the word in the file (call it words_count). Do not make distinction among words with capital letters. \n",
Object-oriented programming Use Java coding.