Lab10act2. Please help me code in python programming. Create a program that produces the three (3) plots described below. Each plot should have theplotted data, a meaningful title to describe the data, labels for the x- and y- axes, and a legendwhen plotting two (2) or more things. Useful hint: to establish an array of x-values, check outnumpy.linspace ().1. One equation for a parabola is given below in terms of its focal length (f):1y =4fWrite the Python code to plot two parabolas as lines on the same plot for the domain-2.0 < x < 2.0 for f = 2 and fline for f6. Choose different colors for each line. Make the= 6 width of 4.0 and the line for f = 2 width of 2.0.Parabola Plots with Varying Focal Length0.50.40.30.2 -0.1f=20.0f=6-1.0-2.0-1.5-0.50.00.51.01.52.0X Third-order polynomials of the form given below:y = Ax³ + Bx² + Cx + D2.I|Write the Python code to plot (x, y) points for for the following set of coefficients for2, B = 3, C = -11, and D = –6. Twenty-five (25)the domain –4.0 < x < 4.0. Let Adata points were used for the plot below.Plot of Cubic Polynomical1251007550250--25-50-4-21234x valuesWrite the Python code to plot sin(x) and cos(x) on the same plot with different colorlines for the domain -2n < x< 2n.3.Plot of cos(x) and sin(x)1.000.75 -0.500.250.00 --0.25-0.50-0.75cos(x)-1.00sin(x)6x valuesPut your code for all three plots in the same ".py file named Lab10a_Act2.py.sənjen Ay values

Hey there, I am writing the required solution based on the above given question. Please do find the…

Create a program that produces the three (3) plots described below. Each plot should have the plotted data, a meaningful title to describe the data, labels for the x- and y- axes, and a legend when plotting two (2) or more things. Useful hint: to establish an array of x-values, check out numpy.linspace (). 1. One equation for a parabola is given below in terms of its focal length (f): www t w 1 y = X x² 4f Write the Python code to plot two parabolas as lines on the same plot for the domain -2.0 < x < 2.0 for f = 2 and f = 6. Choose different colors for each line. Make the line for f = 6 width of 4.0 and the line for f = 2 width of 2.0. %3D Parabola Plots with Varying Focal Length 0.5 0.4 0.3- 0.2 0.1 f=2 0.0 f=6 -2.0 -1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 2.0

Create a program that produces the three (3) plots described below. Each plot should have the plotted data, a meaningful title to describe the data, labels for the x- and y- axes, and a legend when plotting two (2) or more things. Useful hint: to establish an array of x-values, check out numpy.linspace (). 1. One equation for a parabola is given below in terms of its focal length (f): www t w 1 y = X x² 4f Write the Python code to plot two parabolas as lines on the same plot for the domain -2.0 < x < 2.0 for f = 2 and f = 6. Choose different colors for each line. Make the line for f = 6 width of 4.0 and the line for f = 2 width of 2.0. %3D Parabola Plots with Varying Focal Length 0.5 0.4 0.3- 0.2 0.1 f=2 0.0 f=6 -2.0 -1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 2.0

Computer Networking: A Top-Down Approach (7th Edition)

7th Edition

ISBN:9780133594140

Author:James Kurose, Keith Ross

Publisher:James Kurose, Keith Ross

Chapter1: Computer Networks And The Internet

Section: Chapter Questions

Problem R1RQ: What is the difference between a host and an end system? List several different types of end...

See similar textbooks

Related questions

Q: Pseudocode and Python Program Design Requirements Design the pseudocode and a Python program that…

A: This is simple programing questions , takong inputs , calculations and some output . Her is python…

Q: Project 12-4: Monthly Sales Create a program that allows you to view and edit the sales amounts for…

A: Complete answer is given below in Python Programming Language:

Q: Ruby programming. What is the output of the given code? boolean_1 = 77<78 puts(boolean_1)

A: Ruby also supports Boolean i.e true false based on expression validity.

Q: Difficult Python: How do I create a plot y = x^2 and then allow the user to click on its…

A: 1. Import necessary libraries.2. Define on_click(event) function: - Initialize points list. - On…

Q: python The intent of this program is to manage a set of contacts. Each contact will have data…

A: Actually, python is a easiest programming language. It is a dynamically typed programming language.

Q: how do you run a python project with various functions on a website, like HTML? Please explain, I'm…

A: This is a very huge answer to give but basically you need frameworks:

Q: ##PYTHON TIC TAC TOE game includes GuiZero

A: from guizero import App, Box, PushButton, Text def clear_board(): new_board = [[None, None,…

Q: Please make a game or software that uses gui, inheritance, arrays, 2D arrays, classes and methods.…

A: The program is written in Java. Check the program screenshot for the correct indentation. The…

Q: Description Greetings! i Task: Write a program that will ask for the user's name and output their…

A: Importing Necessary Module:The program imports the sys module to access command line arguments…

Q: you locate a JavaScript function? What does it do and when you might use it in your code

A: JavaScript provides functions like most writing and editing languages.

Q: DESIGNING HANGMAN WITH FLOWCHART Can you help me with this please I'm really confused?

Q: how can I create comments in python?

A: In python, # character is used to start the single line comments. Place a hash symbol in front of a…

Q: The idea of the Java servlets is exactly the same as in CGI programs, but the implementation is…

A: It is multithreading based i.e. It uses new thread for every new request. Hence multiple threads…

Q: Title: Pet Care Service Python Program Question: I'm developing a Python program for "Paws and…

A: In this quesiton we have to code in python for the given requirement We have to develop Python…

Q: Please Create a simple C# language payroll program that applies object-oriented concepts. you…

A: Step 1: Declare class Payroll with the fields hoursWorked, hourlyRate, basicPay, overTimeHrs,…

Q: Please write an improved version of the phone book application. Each entry should now accommodate…

A: Algorithm: - Define a global phone_book dictionary to store the entries, with the keys being the…

Q: In Python, how do you clone an object?

A: INTRODUCTION: Assignment statements in Python do not duplicate objects; instead, they form bindings…

Question

100%

Lab10act2. Please help me code in python programming.

Create a program that produces the three (3) plots described below. Each plot should have the
plotted data, a meaningful title to describe the data, labels for the x- and y- axes, and a legend
when plotting two (2) or more things. Useful hint: to establish an array of x-values, check out
numpy.linspace ().
1. One equation for a parabola is given below in terms of its focal length (f):
1
y =
4f
Write the Python code to plot two parabolas as lines on the same plot for the domain
-2.0 < x < 2.0 for f = 2 and f
line for f
6. Choose different colors for each line. Make the
= 6 width of 4.0 and the line for f = 2 width of 2.0.
Parabola Plots with Varying Focal Length
0.5
0.4
0.3
0.2 -
0.1
f=2
0.0
f=6
-1.0
-2.0
-1.5
-0.5
0.0
0.5
1.0
1.5
2.0
X

Third-order polynomials of the form given below:
y = Ax³ + Bx² + Cx + D
2.
I|
Write the Python code to plot (x, y) points for for the following set of coefficients for
2, B = 3, C = -11, and D = –6. Twenty-five (25)
the domain –4.0 < x < 4.0. Let A
data points were used for the plot below.
Plot of Cubic Polynomical
125
100
75
50
25
0-
-25
-50
-4
-2
1
2
3
4
x values
Write the Python code to plot sin(x) and cos(x) on the same plot with different color
lines for the domain -2n < x< 2n.
3.
Plot of cos(x) and sin(x)
1.00
0.75 -
0.50
0.25
0.00 -
-0.25
-0.50
-0.75
cos(x)
-1.00
sin(x)
6
x values
Put your code for all three plots in the same ".py file named Lab10a_Act2.py.
sənjen A
y values

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 4 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Python
would you have any idea for a python code that includes : File I/O, Regular Expressions, Object Orientated Programming, Tkinter GUI many thanks for your help .
Python Programming only plz Create a program to perform the following actions: Create a module that will determine if a string is an email address in this pattern XXXX@XXXX.XXX. you cannot use the regex library. Create a module that determines if a string is a phone number in this pattern XXX-XXX-XXXX. you cannot use the regex library. Then prompt the user: Enter an email address, check to see if the e-mail address is in the correct format. If not ask the user to enter an e-mail address in the correct format. If correct print e-mail accepted. Enter a phone number, check to see if the phone number is in the correct format. If not ask the user to enter a phone number in the correct format. If correct print phone accepted. Print the following: The phone number entered The email address entered Describe the numbers and text you print. Do not just print numbers or strings to the screen explain what each number represents.
Coding in python Please!!I need help please help me in the easiest way to do this coding question. Please do not post it's answer from chegg just use your own skills to write code in easyiest way possible. I will really appriciate your help. Coding language PYTHON : The purpose of this assignment is to help you get comfortable creating and using simple classes and objects. In this assignment, we wish to model a 2-D video game character’s movements. In particular, suppose we are creating a tiny game, where the character can occupy one of 25 squares, like so: The first thing we need to keep track of is the character’s name, so we can differentiate this character from other characters or enemies. The other thing we need to keep track of is the character’s position, i.e., which square they are in. In order to do this, we’ll use an X-Y coordinate system with the origin in the top left corner (the 0,0 square in the picture). So, in the picture, the character occupies square 3, 2;…
Code in C language. Follow instructions in photo. Use text provided as input.txt file. A1, A2 20294 Lorenzana Dr Woodland Hills, CA 91364 B1, B2 19831 Henshaw St Culver City, CA 94023 C1, C2 5142 Dumont Pl Azusa, CA 91112 D1, D2 20636 De Forest St Woodland Hills, CA 91364 A1, A2 20294 Lorenzana Dr Woodland Hills, CA 91364 E1, E2 4851 Poe Ave Woodland Hills, CA 91364 F1, F2 20225 Lorenzana Dr Los Angeles, CA 91111 G1, G2 20253 Lorenzana Dr Los Angeles, CA 90005 H1, H2 5241 Del Moreno Dr Los Angeles, CA 91110 I1, I2 5332 Felice Pl Stevenson Ranch, CA 94135 J1, J2 5135 Quakertown Ave Thousand Oaks, CA 91362 K1, K2 720 Eucalyptus Ave 105 Inglewood, CA 89030 L1, L2 5021 Dumont Pl Woodland Hills, CA 91364 M1, M2 4819 Quedo Pl Westlake Village, CA 91362 I1, I2 5332 Felice Pl Stevenson Ranch, CA 94135 I1, I2 5332 Felice Pl Stevenson Ranch, CA 94135 N1, N2 20044 Wells Dr Beverly Hills, CA 90210 O1, O2 7659 Mckinley Ave Los Angeles, CA 90001
Need help in writing the code in Python!
please help me by giving me an idea for a python code that includes all the following: File I/O, Regular Expressions, Object Orientated Programming, Tkinter GUI many thanks for your help .
Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…
What is a good example of python code for creating an application?
Hi! Please may you write a programming code in C Language, using the instructions in the question attached. Please use either : Microsoft visual studio 2019 or an Online Replit C compiler to do the coding. Thank you very much! If you could also write additonal notes on how you completed the code, that will be really appreciated.