Create a function: -that takes a list and an integer v, -and returns the number of occurrences of v in the list. -Add the NPas variable to count how many times the loop executes in the logarithm = the number of times the loops are executed (and display a message). • The main program must generate a list of random elements (give a matrix no need to generate, just create manually), call the function, and display the result. Example: >>> 13 = [52, 14, 14, 8, 85, 69, 1, 77, 94, 96, 51, 65, 35, 32, 87, 92, 74, 47, 27, 88, 11, 11, 26, 14, 100, 37, 62, 3, 63, 5, 20, 53, 28, 10, 43, 16, 94, 6, 82, 49, 74, 55, 89, 97, 12, 38, 72, 94, 3, 77, 42, 26, 25, 16, 89, 10, 8, 63, 93, 77, 68, 56, 74, 46, 54, 50, 80, 33, 69, 95, 2, 79, 73, 6, 31, 41, 38, 81, 88, 12, 39, 77, 49, 30, 18, 22, 40, 40, 12, 51, 69, 32, 76, 77, 90, 60, 41, 12, 30, 65] >>> account (13,6) Number of steps 100 2

Create a function: -that takes a list and an integer v, -and returns the number of occurrences of v in the list. -Add the NPas variable to count how many times the loop executes in the logarithm = the number of times the loops are executed (and display a message). • The main program must generate a list of random elements (give a matrix no need to generate, just create manually), call the function, and display the result. Example: >>> 13 = [52, 14, 14, 8, 85, 69, 1, 77, 94, 96, 51, 65, 35, 32, 87, 92, 74, 47, 27, 88, 11, 11, 26, 14, 100, 37, 62, 3, 63, 5, 20, 53, 28, 10, 43, 16, 94, 6, 82, 49, 74, 55, 89, 97, 12, 38, 72, 94, 3, 77, 42, 26, 25, 16, 89, 10, 8, 63, 93, 77, 68, 56, 74, 46, 54, 50, 80, 33, 69, 95, 2, 79, 73, 6, 31, 41, 38, 81, 88, 12, 39, 77, 49, 30, 18, 22, 40, 40, 12, 51, 69, 32, 76, 77, 90, 60, 41, 12, 30, 65] >>> account (13,6) Number of steps 100 2

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: What restrictions are possible for viewpoints?

A: Views are used for security purposes in databases, views restrict users from viewing certain columns…

Q: Please provide the top six reasons why you should learn about compilers.

A: Introduction: Any time code is written in one language and then converted to another, a compiler is…

Q: Specify the different types of interfaces.please help me write 1 page

A: Introduction: Here we are asked to specify different types of Interfaces.

Q: What is the maximum amount of characters that may be included in an identification?

A: Introduction: The term "identifier" refers to the name given to items such as variables, functions,…

Q: How do you decide whether a modification should be made?

A: Software modification begins with identifying a need. This call for could occur due to practical or…

Q: How do you compile a personal text set that represents your life, what texts and materials would you…

A: Answer: Introduction: First, let me tell you the basic concept: In each phase, you have encountered…

Q: A programmer reports this problem when using PHP: "It didn't take me long to find out that if you…

A: Answer as follows:

Q: The content is divided into a substantial number of distinct parts and subsections.

A: Introduction: Compiling involves turning a high level language into a low level one. An advanced…

Q: Identify the compiler step that could lead to a syntax error.

A: Here is the explanation regarding the compiler step:

Q: A collating sequence is the sequence, or order, of a character set built into a computer.…

A: It refers to the specific order of characters as defined by the character set used by a…

Q: What type of mistake is usually caused by a misspelled keyword, a missing punctuation character, or…

Q: This LabView code should convert Fahrenheit to Celsius. Select the correct group of icons to…

A: The formula that converts Fahrenheit to Celsius is: C = 5/9*( F - 32 ) So, options a and b are…

Q: The most popular resume format is the Chronological format Direct format Function format Indirect…

A: Refer to step 2 for the answer.

Q: Can you draw the FA please?

A: Language of strings over {a,b}, where each string has exactly 2 b's or exactly 3 b's not more…

Question

Please write your own code, put some commentary for my own understanding. Thank you

Create a function:
-that takes a list and an integer v,
-and returns the number of occurrences of v in the list.
-Add the NPas variable to count how many times the loop executes in the logarithm = the number of
times the loops are executed (and display a message).
• The main program must generate a list of random elements (give a matrix no need to generate, just
create manually), call the function, and display the result.
Example:
>>> 13 = [52, 14, 14, 8, 85, 69, 1, 77, 94, 96, 51, 65, 35, 32, 87, 92, 74, 47, 27, 88, 11, 11, 26, 14, 100, 37, 62,
3, 63, 5, 20, 53, 28, 10, 43, 16, 94, 6, 82, 49, 74, 55, 89, 97, 12, 38, 72, 94, 3, 77, 42, 26, 25, 16, 89, 10, 8,
63, 93, 77, 68, 56, 74, 46, 54, 50, 80, 33, 69, 95, 2, 79, 73, 6, 31, 41, 38, 81, 88, 12, 39, 77, 49, 30, 18, 22,
40, 40, 12, 51, 69, 32, 76, 77, 90, 60, 41, 12, 30, 65]
>>> account (13,6)
Number of steps 100
2

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

Please help me with this 1. Create a t squared tractal 2. create a viscek fractal (comment the code)
defin Terms : form criticism, source criticism, canonical criticism, Textus Receptus, textual variant, version
Explain the compiler's structure and how the code may be tested.
What are the essential elements for creating a loop? Determine two circumstances that may necessitate two distinct loop types. Make careful you include explicit information for each situation that show why the various loop types are essential.
SyntaxError: invalid syntax (<string>, line 56)
Write the Java statement to create an instance of a Rectangle with a width of 4 and a length of 8. Edit View Insert Format Tools Table
You have an equation r = 3*x^2 - 7*x+ 14. Write the MATLAB code to create a symbolic plot of x on the horizontal and r on the vertical axis from x = -10 to x = +10. (provide the code that can create the plot. Do not need to attach the plot below) %3D
A wavy line will appear at the cursor's current position in the code editor.
You need to show detail work on how you get the answer. Dont use answers from other websites please! Please type your answer not picture Convert 25.84375 to binary (maximum of six places to the right of the binary point) View keyboard shortcuts
Please provide a list of the top six reasons why it's useful to understand how compilers work.
Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…
Q : Give a detail description of genetic algorithm used in various field.