Consider the following code segments: 1: function Fun Rec(k) 2: if k=0 then: 3: return 0 4: 5: 6: 7: end function else: return Fun Rec(k-1) + k end if 8: 9: result = 0 10: forj=1 to n do 11: result = result + FunRec(j) 12: end for 13: Print result (a) When Fun Rec(k) is called (assume k is an integer and k > 0), how many times is the function called before the initial call is terminated? Give the answer in terms of k. (b) What does Fun Rec(k) return? Give the answer in terms of k. (c) How many times is Fun Rec called in total? Include the calls on line 11 as well as the recursive calls. Give the answer in terms of n. (d) What is final value of result in line 13? Give the answer in terms of n.

Consider the following code segments: 1: function Fun Rec(k) 2: if k=0 then: 3: return 0 4: 5: 6: 7: end function else: return Fun Rec(k-1) + k end if 8: 9: result = 0 10: forj=1 to n do 11: result = result + FunRec(j) 12: end for 13: Print result (a) When Fun Rec(k) is called (assume k is an integer and k > 0), how many times is the function called before the initial call is terminated? Give the answer in terms of k. (b) What does Fun Rec(k) return? Give the answer in terms of k. (c) How many times is Fun Rec called in total? Include the calls on line 11 as well as the recursive calls. Give the answer in terms of n. (d) What is final value of result in line 13? Give the answer in terms of n.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Python program (recursive function) A recursive function is a function defined in terms of itself via self-referential expressions. This means that the function will continue to call itself and repeat its behavior until some condition is met to return a result. Write a python recursive functionprod that takes x as an argument, and returns the result where, result=1*1/2*1/3*….*1/n Include a screenshot that shows a python program that uses the above function and prints the rounded result to three decimal placesafter prompting the user to enter a number, x. Use x=3. N.B: The code should be included please.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
#include // Function to calculate the factorial of a given positive integer int factorial(int n) { // TODO: Implement the factorial function here } int main() { int num; printf("Enter a positive integer: "); scanf("%d", &num); // TODO: Call the factorial function and print the result } return 0; • Q1: Write a C program to calculate the factorial of a given positive integer entered by the user.
A recursive function in programming is a function that calls itself during its execution. The following two functions are examples of recursive functions: def function1(length): if length > 0: print(length) function1(length - 1) def function2(length): while length > 0: print(length) function2(length - 1) What can you say about the output of function1(3) and function2(3)? The two functions produce the same output 3 2 1. function1 produces the output: 3 2 1 and function2 runs infinitely. 3. function1 produces the output: 3 2 1 and function2 runs infinitely. 4. The two programs produce the same output: 1 2 3
language: Python Problem: Write a recursive function to add a positive integer b to another number a, add(a, b), where only the unit 1 can be added, For example add(5, 9) will return 14. When creating the function, also create a test case to prove the program works. The pseudocode is: # Base case: if b is 1, you can just return a + 1# General case: otherwise, return the sum of 1 and what is returned by adding a and b - 1
Instructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.
*You need to have at least one user define function *Language: C programming Write a C Program to print half pyramid using numbers shown below. This example is for height 6. Ask user for a height and depending on user input, draw the half pyramid. Input: Key in the height: 6 Output: 1 1 2 1 2 3 1 2 3 4 1 2 3 4 5 1 2 3 4 5 6
Using Stucture in C programming language create a program with a user-defined function that asks for name and age of 5 person and display all inputs in ascending order according to age. Sample Output: Enter name of Person [1]: Juan Age: 22 Enter name of Person [2]: Anton Age: 23 Enter name of Person [3]: Bullet Age: 18 Enter name of Person [4]: Craig Age: 19 Enter name of Person [5]: Mario Age: 20 Name: Age: Bullet 18 Craig 19 Mario 20 Juan 22 Anton 23
python module must define four functions:a. add(a, b)b. subtract(a, b)c. multiply(a, b)d. divide(a, b)i. Divide must check for division by zero and return an error message if itencounters it.3. Each function should take two arguments and perform the corresponding mathematicaloperation. Return the result, don’t print it in the function.4. Include a main() function that tests these functions with some example inputs. Ensurethat you print the results of the function calls here in the main function and provide theappropriate labels.5. The main() function must only run automatically if the module is being run directly, notwhen imported.
1.Please use recursive function principle and use Visual Studio or Xcode to create a function called: f (int n), which will be calculated based on following formula: f (n) = [1+f (n-1)] *2 f (0) = 0 2. Please design another function called fibonacci function: fibonacci (int n), which will be calculated based on following formula: fibonacci ( int n) = fibonacci (n-1) + fibonacci (n-2) fibonacci (0) = 0 fibonacci (1)=1 3. Please copy and paste your source code here. You don't need to compile and execute your source code. The format will be like: #include <iostream> #include <cmath> using namespace std; int f ( int n) { } int fibonacci ( int n) { }
Python Help Write a function rectangle_area(length, width)Write a function rectangle_perimeter(length, width)Write a function circle_area(radius)Write a function circle_circumference(radius)Write a main function that asks the user to choose whether to find the area of a rectangle, the perimeter of a rectangle, the area of a circle or the circumference of a circle. If the user chooses to find the area of a circle use circle_area function, if the user chooses to find the area of a rectangle use rectangle_area function and so on.