Answered: Consider the code fragment: int ctr=1;…

Engineering

Computer Science

Consider the code fragment: int ctr=1; do{ ctr += 2; printf(“%d “,ctr); }while(ctr <= 15); what is the output

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: PYTHON HOMEWORK QUESTION def area(side1, side2): return side1 * side2 s1 = 12 s2 = 6 Select…

A: Here, a function area is defined which is accepting 2 arguments and then returning the area by…

Q: Compute: z = x/|y| #include #include int main(void) { double x; double y; double z;…

A: We're embarking on a journey into the world of programming, focusing on a seemingly simple yet…

Q: FLEX & YACC hw Please add commentaries inside the code Make calculator also run with float…

A: FLEX and YAXCC to create a calculator

Q: Complete and modify the code:

A: Q: Complete and modify the code:

Q: The program segment has errors. Find as many as you can. // This code should average a set of…

A: Step 1:- Program:- #include <iostream>using namespace std;int main(){int numCount,…

Q: #include int main() { int arr[10]; int i; for (i=0; i<10; i++){ arr[i] =…

A: As given, we need add the following code parts to the given code - (1) Copy the content of the first…

Q: 1- define a second argument (example "int number2 = 9") and a pointer to it 2- define a second…

A: The function accepts two integer references and adds the numbers present in both references and…

Q: The stop value is not included in the range() function in the Python language. An equivalent of…

A: Tip: When you use range() with a single statement, you'll obtain a series of numbers that starts at…

Q: Messenger O Sender O Receiver Source

A: In the communication process, Sender generates an idea.

Q: Let U = {0, 1,2, ...,9}, A = {1, 2, 5, 8, 9}, B = {0, 1, 3, 4}, and C (AU B) nC = AU (Bn C) = A – (B…

A: Set Operation: Union: It is denoted by ∪ symbol. Let's take two sets A & B, then A∪B contains…

Q: function triangular_number() { echo "Enter the range of numbers (start end): " read start end…

A: A flowchart is a visual representation of a process or algorithm using various shapes and symbols to…

Q: int f(int &k) { k++; return k * 2; } int main() { int i = 1, j = -1; int a, b, c; a = f(i) + i/2; b…

A: The provided C++ code presents a concise illustration of function calls and variable assignments,…

Q: Complete the code: string cars[5] = {"Volvo", "BMW", "Ford", "Mazda", "Honda"}; for(int i = 0; i< _;…

A: string cars[5]={"Volvo","BMW","Ford","Mazda","Honda"}; for(int i=0;i<5;i++){…

Q: In C++ I need to compose a function that accepts an array of integer values as an argument and…

A: Program Instructions:Pass array to the function getSum().Use the reference of the array to get the…

Q: What's wrong with this code? float q;int *p;q = 100.7;p = &q;

A: The objective of the question is to identify the error in the given piece of code.

Q: Each of the following definitions and program segments has errors. Locate as many as you can and…

A: void showValues(int nums[ ]) *// Definition of the function showValues. { for (int…

Q: C++ Coding: Branching Write one line of code to print a random value between -20 and 12 inclusive.

Q: Problem Descriptions: In this problem, your task is to write a program to find whether a…

A: Since no specific language is mentioned so writing the program in C++ language. CirclePoint.cpp…

Q: #include #include int MAX_SIZE = 10; int n = 0; //A counter variable which will keep track of…

A: The objective is to solve the given code using struct type.

Q: Rewrite the code snippet in "What is the Output, Question #1" using do-while loops

A: Introduction: Write in do-while loop

Q: Make an add func() function with two parameters. The function should sum the two inputs and return…

A: logic:- define a function add_funct with two parameters a and b. return a+b if both the numbers…

Q: C++ Coding: Branching Write one line of code to print a random value between -10 and 22 inclusive.

Q: C++ What is the output? int columns; int rows; for (rows = 0; rows < 2; ++rows) { for…

A: Given: C++ What is the output? int columns;int rows;for (rows = 0; rows < 2; ++rows) {…

Q: 37. #include <s nt main() { int num = 5; hui %3D printf(" The v

A: Explanation: In given we are trying to print the integer variable here "%d" refers to that we are…

Q: #include int main() { int y = 10000; int y - 34; printf("Hello world! %d\n", y);

A: Given, Code: #include <stdio.h> int main() { int y = 10000; int y = 34;…

Q: Static Variable: a variable whose lifetime is the lifetime of the program (static int x;) Dynamic…

A: Given: Static Variable: a variable whose lifetime is the lifetime of the program (static int x;)…

Q: The following function has errors. Locate as many errors as you can. void area(int length = 30, int…

A: Correction Explanation: The argument length should be declared inside the function body or at the…

Q: #include #include #include int main(void){ int money_start, bet, money_bet; int…

A: Objective: A program is provided for implementing the roulette game where a player will play the…

Q: 1. Why does little-endian vs. big-endian matter here in this code 2. Describe how pointer casting…

A: Answer: I have given answer in the brief explanation.

Q: #include using namespace std; int times(int mpr, int mcand) { int prod = 0; while (mpr != 0)…

A: Actually, program is a executable software that runs on a computer.

Q: #include #include int MAX_SIZE = 10; int n = 0; //A counter variable which will keep track of…

A: Task : In the given C code, the output of the code is not correct. The task is to debug the code…

Q: #include #include int MAX_SIZE = 10; int n = 0; //A counter variable which will keep track of…

A: the program is given below:-

Q: Compare Numbers - Python Language please! Programming challenge description: Little Tommy is in…

A: Step 1 : STARTStep 2 : implement the function compare_numbersStep 3 : input 2 numbersStep 4 : store…

Q: SYNTAX ERROR HELP - PYTHON This also happens for several other 'return result' lines in the code.…

A: Algorithm:Import the random module.Define a function rollDice to simulate rolling two six-sided dice…

Q: Consider the following pseudo code, Method func() { PRINT “This is recursive function" func() }…

A: According the Question below the solution:

Q: int main() { string str; int count = 0; // user input cout > str; int n =…

A: C program to solve the given problem is below.

Q: Which aggregating operations are permitted for struct variables but not array variables, and which…

A: What is programming: Programming is the process of designing, writing, testing, and maintaining…

Q: Q8. RUN AND FIND OUTPUT - #include #include main() { if(UCHAR_MAX<=SCHAR_MAX) printf("hello"); else…

A: Given, Code: #include<stdio.h> #include<limits.h> main() {…

Q: Given C code: #include typedef struct compound { float realNumber; float imaginaryNumber; }…

A: I have changed your logic in compound function which was previously returning addition of two…

Q: #include using namespace std; int times(int mpr, int mcand) { int prod = 0; while (mpr != 0)…

A: Converting c++ program into pep/9 assembly language The given c++ code is#include…

Q: What value will be returned by the function if a = 8, b=12? int func(int a, int b){ if(a>b){ return…

A: Find the value returned by the given function named "func" if the parameters are a=8 and b=12.

Q: int x1 = 66; int y1 = 39; int d; _asm { } mov EAX, x1; mov EBX, y1; push EAX; push EBX; pop ECX mov…

A: Here we have given a code fragment in assembly language, our task is to find the value of d in…

Q: Why does little-endian vs. big-endian matter here in this code

A: Answer: Little-endian: The little-endian show is a kind of addressing that alludes to the request…

Question

Consider the code fragment:
int ctr=1;
do{
ctr += 2;
printf(“%d “,ctr);
}while(ctr <= 15);

what is the output

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Solution:

VIEW

Explanation:

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

In the C programming language, if all function prototypes are listed at the top of your code, outside and above all functions, you do not need to worry about the order of the function definitions within the code. True False
#include <stdio.h>#include <stdlib.h> int MAX_SIZE = 10;int n = 0; //A counter variable which will keep track of number of elements in arr. void append(int *arr, int element){ if(n == MAX_SIZE) { MAX_SIZE = MAX_SIZE * 2; int *ptr = (int*)malloc(MAX_SIZE * sizeof(int)); //Copy elements of existing array to a new array for(int i=0;i<n;i++) { ptr[i] = arr[i]; } arr = ptr; n++; } arr[n] = element;} int get(int *arr, int index){ return arr[index];}int main(){ int *arr = (int*)malloc(MAX_SIZE * sizeof(int)); n = 10; for(int i=0;i<n;i++) arr[i] = i+1; printf("\nArray size: %d", MAX_SIZE); printf("\nNumber of elements: %d", n); printf("\nArray: "); for(int i=0;i<n;i++) printf("%d ", arr[i]); printf("\n\nAdding an element"); append(arr, 11); printf("\nArray size: %d", MAX_SIZE); printf("\nNumber of elements: %d", n);…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
int main(){ long long int total; long long int init; scanf("%lld %lld", &total, &init); getchar(); long long int max = init; long long int min = init; int i; for (i = 0; i < total; i++) { char op1 = '0'; char op2 = '0'; long long int num1 = 0; long long int num2 = 0; scanf("%c %lld %c %lld", &op1, &num1, &op2, &num2); getchar(); long long int maxr = max; long long int minr = min; if (op1 == '+') { long long int sum = max + num1; maxr = sum; minr = sum; long long int res = min + num1; if (res > maxr) { max = res; } if (res < minr) { minr = res; } } else { long long int sum = max * num1; maxr = sum; minr = sum; long long int res = min * num1;…
please code in python regular expression In some web forms, users must enter a phone number, and some of these aggravate users byaccepting only a specific format. You have been hired to write a program that reads U.S. phone numbers with the three-digit area and seven-digit local codes accepted as ten digits, or separated into blocks using hyphens or spaces, and with the area code optionally enclosed in parentheses. For example, all of these are valid: 555-123-1234, (555) 1234567, (555) 123 1234, and 5551234567. Read the phone numbers from user input and for each one echo the number in the form “(999) 999 9999” or report an error for any that are invalid, or that don’t have exactly ten digits.
Program C Loop, pls help ASAP int getNum(); /*accepts input from the user.*/ void display(int num); /*prints the number pattern*/ ---------------------------------------------------------------------
// Assume all libraries are included 3 void func (int a, int &b, int &c); // int main () { int i = 5, j = 4, k = 33; 4 7 %3D 8. func (i, j, k); func (j, i, k); cout << j « k << i <« endl; 10 11 12 13 return 0; 14 } // 15 16 void func (int a, int &b, int &c) { 17 18 = 2*c + b; 19 b a; 20 C = a + 3*b; } // 21 22 I|||
editable source code: instructions are on the photo #include<stdio.h> int main(void) { int a, b, c, d; printf("Enter a: "); scanf("%d", &a); printf("Enter b: "); scanf("%d", &b); printf("Enter c: "); scanf("%d", &c); printf("Enter d: "); scanf("%d", &d); int highest = getBest(a, b, c, d); printf("Highest integer = %d", highest); return 0;}
#include #include #include #define SIZE 5 int nums [SIZE] = [5,0,6,1,2); int main() { int i; pid_t pid; pid= fork(); if (pid == 0) { for (i = 0; i 0) { wait (NULL); } for (i = 0; i < SIZE; i++) printf("PARENT: %d\n", nums [i] + 1); /* LINE Y */ return 0; From the above-given program, please state what will be the output at lines X and Y. Explanation in detail required for output at both lines X and Y.
What value does function Joy return when called with a value of 4?int Joy (int Q){ if (Q <= 1) return 1; else return Q * Joy(Q-1);}
C++ What will be the range of the random numbers generated by the following code snippet? fand () = 100 + 1; A) Between I and 100 B) Between 0 and 99 c) Between 0 and loo D) Between I and 99
#include <stdio.h>#include <limits.h> int findMissingUtil(int arr[], int low, int high, int diff){ if (high <= low)return INT_MAX; int mid = low + (high - low)/2; if (arr[mid+1] - arr[mid] != diff)return (arr[mid] + diff); if (mid > 0 && arr[mid] - arr[mid-1] != diff)return (arr[mid-1] + diff); if (arr[mid] == arr[0] + mid*diff)return findMissingUtil(arr, mid+1, high, diff); return findMissingUtil(arr, low, mid-1, diff);} int findMissing(int arr[], int n){int diff = (arr[n-1] - arr[0])/n; return findMissingUtil(arr, 0, n-1,diff);} int main(){int arr[] = {120001, 120013, 120025, 120037, 120049, 120061,120085,120097,120109,120121};int n = sizeof(arr)/sizeof(arr[0]);printf("The missing element is %d", findMissing(arr, n));return 0;} ______________________________________________________________________________ Convert the code above into Pseudocode