Compute the following postfix expressions: a) 8 2 + 3 * 16 4/ b) 12 25 5 1 || *8 7 + - = c) 70 14 4 5 15 3/ * - - / 6 + =| d) 3 5 6 * + 13 - 18 2 / + =
Q: 3) The initial sate : A {A,B} {C} {D} The final state : {D} {A} {C} A В Ø
A: a) the initial stage A, The final stage D 0 1 A {A, B} {A} B {C} {C} C {D} ∅ D {D} {D}…
Q: Complete and modify the code:
A: Q: Complete and modify the code:
Q: Write a program in C to print a diamond using *. Ask the use to input the height of the pyramid.…
A: Please find the answer below :
Q: How do I set a boolean hasDigit to true if string userInput contains a digit? bool hasDigit; string…
A: Please find the answer below :
Q: Find the error/s in the following code, highlight and write the correct code. MATLAB discr == b*b -…
A: discr == b*b - 4*a*c; Use assignment operator here Correct Use: discr = b*b - 4*a*c; else discr =0…
Q: 1- define a second argument (example "int number2 = 9") and a pointer to it 2- define a second…
A: The function accepts two integer references and adds the numbers present in both references and…
Q: C programming code to check 8 digits if it gives 0 when mod 11.
A: C: C is a general purpose programming language. It was developed by Dennis Ritchie in the year 1972.…
Q: Stack using C++ programmijng language please Write a program to input an arithmetic expression, then…
A: Given: Stack using C++ programmijng language please Write a program to input an arithmetic…
Q: b = a*a; a*a*a; d = |(a); fprintf('%4u square equals %4u \r', a, b) fprintf('%4u cube equals %4u…
A: a = 10;b = a*a;c = a*a*a;d = sqrt(a); fprintf('%4u square equals %4u \r', a, b);fprintf('%4u cube…
Q: c++ code to Calculate the average score of each player using the chart given: 1st player: 286 262…
A: Include the header files In main function declare the variable to store the players scores and to…
Q: C++ input integer n , ouput n to the power of 2 can't use function power() , use loop example:…
A: As given, we need to write a C++ program, that takes an input integer n and outputs n to the power…
Q: Develop a function called "randomPairsGenerator" that generates and displays pairs of random…
A: SOLUTION-I have solved this problem in C++ code with comments and screenshots for easy…
Q: QUESTION: Write a C++ program that will generate and display a magic square. A magic square is a…
A: C++ code #include<iostream>#include<iomanip>using namespace std; const int MAX_SIZE =…
Q: C++ Programming Request a 3-digit integer from the console. Use division and modulo operations to…
A: ********* C++ Executable Program ************ #include <iostream> using namespace std; int…
Q: The correct statements are: For L = 0, L = {e} For L = {}, L* = {e} L+ = LL* OL+ OL* = LL+
A: The query seems to be about formal language theory and properties related to the Kleene closure and…
Q: 2. а) Construct a DFA for the following Regular Expression: d(ab|b|bc) d|ba(b(b/c)da)'d b) Construct…
A: a) Given Regular expression is: d(ab|b|bc)d|ba(b(b|c)da)*d The Deterministic Finite Automata (DFA)…
Q: Allowed languages C Problem Statement Given four points of the form: x1,y1,x2,y2,x3, y3,x4,y4 -…
A: //C program #include <stdio.h> int main() { int n,x1,x2,x3,x4,y1,y2,y3,y4;…
Q: C++ - When analyzing data sets, such as data for human heights or for human weights, a common step…
A: Step 1:- Program Approach:- (i)Declare one header file (ii)Declare 3 variable of type integer…
Q: b) 10 20 + 25 15 - * 30/ c) 5 7 3 + * 8 4 /-
A: For evaluating postfix operation, Push operands onto stack . When operator is encountered, pop top…
Q: The quadratic formula is used to solve a very specific type of equation, called a quadratic…
A: PROGRAM EXPLANATION: - The Disc.py contains the discriminant function having three parameters for…
Q: C Programming Please: #include #include int main() Write a program to model a simple…
A: see the code in c programming language
Q: 2- Write a pyhton function that prompts the user to input three integers and prints the sum of those…
A: Given: 2- Write a pyhton function that prompts the user to input three integers and prints the sum…
Q: Write a C Program that will compute for npr (n taken r permutations).
A: Approach Start Include header files Declaration of the function prototype Main method Variable…
Q: Write a machine language program to input two one-digit numbers, add them, and output the one-digit…
A: Lets discuss the solution in the next steps
Q: c ++ Using bitwise operators, create a function capable of printing a number in binary format.…
A: Given: c++ Using bitwise operators, create a function capable of printing a number in binary format.…
Q: Write a program that accepts an integer and prints the range of numbers starting from 1 to the input…
A: Introduction: In this question, we are asked to write a C++ program to print non prime number within…
Q: C++ CODE ONLY: Write a program that takes as input five numbers and outputs standard deviation of…
A: Code: #include <iostream>#include<bits/stdc++.h>using namespace std; float mean(int ,…
Q: C: Array & Loop
A: C code: #include<stdio.h>#define MAX 10void main(){int a,b,ch,n,i,j,k,l=0,p,f=0,sum=0;char…
Q: 3. Intermediate Code The following statement is known: A = - A * (A + B ) - (B – C) / D Plrase make:…
A: The following statement is known:A = - A * (A + B ) - (B – C) / D
Q: Rewrite the following code segment using conditional operators (?/:) double discount_percent; if…
A: The conditional (ternary) operator is the only JavaScript operator that takes three operands: a…
Q: 1. Convert the following while loop to a do-while loop: [2 marks] int count = 0; while (count < 50)…
A: while loop: checks the conditional statement before iterating, means before every iteration it…
Q: c++ Use input validation to read two whole whole numbers, A and B, // which must satisfy the rule…
A: Check the answer below.
Q: Using C not(C++ or C#) without the use of strings and arrays, I need help in coding this small…
A: Given : Input the number in C. Return the place value.
Q: Write C program (NOT C++) which takes as input a positive integer n and decides whether or not n is…
A: So according to the question, we need to write a code which will return whether a number entered by…
Q: ++ input a positive integer, output binary use loop can't use recursive or other function example:…
A: Program Approach: 1- Prompt a message to take the input from a user. 2- Store a user entered a…
Q: 1) Find the errors in the following codes: int Main() { } int { Hanging Indent #include ; int a =…
A: The above question is answered in step 2 :-
Q: IN C LANGUAGE Prompt the user to enter no of rows and columns and print ASCII characters in…
A: We have to write a program which prints the following pattern using alphabets in C programming…
Q: x - 32 z= sin(x) + 4 :x = 0 :x>0) main () { int z,x; cin>>x; .... else z=sqrt(x); cout0) z=x-32;…
A: Given If x<0 then z= x-32 If x =0 then x =sin(x) +4 If x>0 then z = x To implement given…
Q: Write a one-liner C statement that declares an integer variable day and a pointer pday (use one…
A: I have provided one line statement , C CODE along with CODE SCREENSHOT WITH…
Q: Assume a, b, c and n are float variables, and d, e, fand m are integer variables, what is the result…
A: As I have read the guidelines I can provide answers to only 1 part of the questions in case of…
Q: Programming Language: Python 5. Write a Python function that will take a positive integer n from…
A: Start take number n call function prime_number return 1 if prime else return 0 stop
![Compute the following postfix expressions:
a) 8 2 + 3 * 16 4/
b) 12 25 5 1 /| * 8 7 + - =
70 14 4 5 15 3 / * - -
/ 6 + =
d) 3 5 6 * + 13 - 18 2 / + =](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F7af957eb-a40e-444e-862d-69a75fae4507%2Fc5f97860-3105-4963-923c-69449a872962%2Fsip98zq_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 5 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Complete the C++ function given below: int evenDigits(int n){//returns the number of even digits in n}***IN PSUEDOCODE ONLY - not a real programming language!!*** Question:A prime number is a number that is only evenly divisible by itself and 1. For example, the number 5 is prime because it can only be evenly divided by 1 and 5. The number 6, however, is not prime because it can be divided evenly by 1, 2, 3, and 6. Design a Boolean function called isPrime, that accepts an integer as an argument and returns True if the argument is a prime number, or False otherwise. Use the function in a program that prompts the user to enter a number and then displays a message indicating whether the number is prime. The following modules should be written: - getNumber, that accepts a Ref to an integer, prompts the user to enter a number, and accepts that input - isPrime, that accepts an integer as an argument and returns True if the argument is a prime number, or False otherwise - showPrime, that accepts an integer as an argument , calls isPrime, and displays a message indicating whether the…Note:solution using c++ language Pre-Lab 01: Write a program that reads a positive integer x from the user. If x is even, the program prints all the odd numbers between 1 and x – inclusive - each on a separate line. If x is not even, the program prints all the numbers that are multiples of 4 between 1 and x+10 -inclusive -, each on a separate line. Note: As long as the user does not enter a positive number, the program will repeatedly ask the user to enter a positive number. The program must also print an error message "Error- TRY AGAIN – You should enter a positive integer to continue". Úe do.. while to insure the user input.
- Module/Week 2 ASSIGNMENT (INPUT/OUTPUT)The number of permutations of a set of n items taken r at a time is given by the following formulan !⁄r !(n-r)!: where n! is the factorial of n, r! is the factorial of r, and (n-r)! is the factorial of the result of n-r. The factorial of a number n can be solved using the following formula: 〖n!=e〗^(-n) n^n√2πn. If there are 18 people in your class and you want to divide the class into programming teams of 3 members, you can compute the number of different teams that can be arranged using this formula (n !⁄r !(n-r)!). Write a C++ program that determines the number of potential team arrangements. You will need to use the double type for this computation. Use the Lab Template you set-up last week, proper formatting, and appropriate comments in your code. The output must be labeled clearly and formatted neatly. Submit C++ Programming Assignment 2 by 11:59 p.m. (ET) on Monday of Module/Week 2.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…#include // Function to calculate the factorial of a given positive integer int factorial(int n) { // TODO: Implement the factorial function here } int main() { int num; printf("Enter a positive integer: "); scanf("%d", &num); // TODO: Call the factorial function and print the result } return 0; • Q1: Write a C program to calculate the factorial of a given positive integer entered by the user.
- This is under C programming not C++ please include screenshot of the program and the compiler. Sample output is provided below. Ask the user to input an n number of arrays and the program should be able to do the following functions:a) Find an average of an input arrayb) Find the highest value from the input arrayc) Search for a particular number from the input array (should give the indexorindices if there are more than 1)Fundamentals of Programming in C Language Write the value of each of the following expressions, using the following data declarations: double m = 17.5; int y = 9; 1. (m > 12.0) && (y / 2 <= 4) 2. (y % 3 != 0) 3. (m < 2 * y) 4. (2 == 3) || (m - 16 >= 0)C++ Programming Language: Enhance the code given by outputting: The largest number of the sequence a0 ,a1 ,a2 , ..., ak. The position of the largest number Test your program for the following values of x: 75, 111, 678, 732, 873, 2048, and 65535. Example: "For example, for the input sequence: 75, 226, 113, 340, 170, 85, 256, 128, 64, 32, 16, 8, 4, 2, 1, the program output should contain the following: The largest number of the sequence is 340 The position of the largest number is 4" Code Given: #include <iostream> #include <iomanip> using namespace std; int main() { long x; int count; long a_n; cout << "Enter a nonnegative integer: "; cin >> x; cout << endl; count = 0; a_n = x; cout << a_n << ", "; while (a_n !=1) { if (a_n %2==0) a_n = a_n / 2; else a_n = 3 * a_n + 1; count++; cout << a_n <<", "; } cout << endl; cout << "The integer k such that a_k = 1 is " << count << endl; return0; }
- C++ Option 3: Sum series Write a function to compute the following series: 15 n(n+2) Write a main function that displays the following table by calling the above function where n- 14: n F24 12 14 f(n) 0.458333 0.566667 0.675824 0.685417*Modify the program so that the user will error trap for only 1 and 0 as an input. *If the user enters an input other than 1 or 0 display an error message and request the user enter that input again. *Do this for all inputs in the code. # User defined function for logic OR# The function takes two parameters and returns a single intdef OR(a: int, b: int)->int:# If a is equal to 1 return 1if a == 1 :return 1# If b is equal to 1 return 1elif b == 1 :return 1# If a and b is equal to 0 return 0else :return 0 # User defined function for logic NOR# The function takes two parameters and returns a single intdef NOR(a: int, b: int)->int:# If a is equal to 0 and b is also equal to 0 return 1if a == 0 and b == 0 :return 1# If a is equal to 0 and b is equal to 1 return 0elif a == 0 and b == 1 :return 0# If a is equal to 1 and b is also equal to 0 return 0elif a == 1 and b == 0 :return 0# If a is equal to 1 and b is also equal to 1 return 0elif a == 1 and b == 1 :return 0 # User defined…Problem Statement The barcode used by the U.S. Postal System to route mail is defined as follows: Each decimal digit in the ZIP code is encoded using a sequence of three half-height and two full-height bars. The barcode starts and ends with a full-height bar (the guard rail) and includes a checksum digit (after the five-digit ZIP code or ZIP + 4), computed by summing up the original digits modulo 10. Define the following functions: Draw a half-height or full-height bar on stddraw. Given a digit, draw its sequence of bars. Compute the checksum digit. Also define global code that read in a five- (or nine-) digit ZIP code as the command-line argument and draws the corresponding postal barcode.
![Database System Concepts](https://www.bartleby.com/isbn_cover_images/9780078022159/9780078022159_smallCoverImage.jpg)
![Starting Out with Python (4th Edition)](https://www.bartleby.com/isbn_cover_images/9780134444321/9780134444321_smallCoverImage.gif)
![Digital Fundamentals (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780132737968/9780132737968_smallCoverImage.gif)
![C How to Program (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780133976892/9780133976892_smallCoverImage.gif)
![Database Systems: Design, Implementation, & Manag…](https://www.bartleby.com/isbn_cover_images/9781337627900/9781337627900_smallCoverImage.gif)
![Programmable Logic Controllers](https://www.bartleby.com/isbn_cover_images/9780073373843/9780073373843_smallCoverImage.gif)
![Database System Concepts](https://www.bartleby.com/isbn_cover_images/9780078022159/9780078022159_smallCoverImage.jpg)
![Starting Out with Python (4th Edition)](https://www.bartleby.com/isbn_cover_images/9780134444321/9780134444321_smallCoverImage.gif)
![Digital Fundamentals (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780132737968/9780132737968_smallCoverImage.gif)
![C How to Program (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780133976892/9780133976892_smallCoverImage.gif)
![Database Systems: Design, Implementation, & Manag…](https://www.bartleby.com/isbn_cover_images/9781337627900/9781337627900_smallCoverImage.gif)
![Programmable Logic Controllers](https://www.bartleby.com/isbn_cover_images/9780073373843/9780073373843_smallCoverImage.gif)