Ciprofloxacin is an antibiotic that interferes with the activity of DNA gyrase. Which of the following is a direct consequence of ciprofloxacin treatment of a bacterial cell? O DNA replication would stop due to the inability to relieve supercoiling OTranslation would not occur because the ribosome subunits would not recognize MRNA Alternative splicing of introns would not take place RNA polymerase would not be able to initiate transcription

Ciprofloxacin is an antibiotic that interferes with the activity of DNA gyrase. Which of the following is a direct consequence of ciprofloxacin treatment of a bacterial cell? O DNA replication would stop due to the inability to relieve supercoiling OTranslation would not occur because the ribosome subunits would not recognize MRNA Alternative splicing of introns would not take place RNA polymerase would not be able to initiate transcription

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat O DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariat
Name each of the processes pictured: -RNA 5' TCAC CÁCTCAT 3' TACCACCTA 3' UUCAC CACUCAU U 5' DŇA RNA polymerase Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 Spliced RNA 000 Exon 1 Exon 2 Exon 3 AAAAAAA polypeptide chain Met Phe Arg P E UAC AAA GCU AUGUUUCGA Ribosome There are possible nucleotide "triplets" or
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…
What is the RNA transcript that would result from the double stranded DNA segment shown below? 5'-GCACGTTGGTCGATCACGTAATATACGCATCGACTCCCGATCGA-3' 3'-CGTGCAACCAGCTAGTGCATTATATGCGTAGCTGAGGGCTAGCT-5' 5'- ين
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
DNA replication in bacteria begins at a single origin and proceeds in one direction a single origin and proceeds in both directions two origins and proceeds in both direction many origins and proceed in one direction none of the above . Coupling of transcription and translation is found where? near type II RNA polymerase activity in prokaryotic cells within the eukaryotic nucleus at the ribosomal complex A frameshift mutation has more consequences than point mutation because a frameshift mutation can not ever be transcribed into mRNA molecule prevents uracil from being used in the mRNA molecule only affects a single codon causes all of the codons after it to be different choose the correct number in each questions
Assume that you are a RNA polymerase. Which strand is the template strand? -5 ↓ 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…