CH-C-2CoA 28. a triglyceride 29. a seap 30. a glycerophinplolipid

Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…

A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…

Q: sh 39 (a) Using proper nomenclature, determine the genotypes of the P and F1 generation. a il…

A: If the genes are located on the same chromosome then they are called linked genes and they do not…

Q: Part 1: Graphing Biotic Potential 1. Make a table to show the data (# flies/generation). for one…

A: Given that one female fly can produce 120 eggs in one generation. Of these 120 eggs, half (60) will…

Q: How would the immediate loss of ATP likely influence the delivery of uncoated vesicles to their…

A: Answer of the question is option "C" Vesicle transport is the way of transport protein in…

Q: 22) If both married couples have the sickle cell trait (AS), what is the possible combination of…

A: The mode of inheritance is a pattern of obtaining parentral alleles  or genes to the offsprings. The…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: The photomicrograph below shows mitotically dividing cells from whitefish (Coregonus lavaretus). a.…

A: Mitotic division: it is also known as equal division because each daughter cells have a copy of…

Q: Which of the following is not an example of an adjustment in parenting due to an increased crime…

A: Adjustments in parenting due to an increased crime rate are changes that parents make to ensure…

Q: bone density. Research health problems that are faced by post-menopausal women due to changes in the…

A: Estrogen is a female hormone, It is helpful in developing and maintaining the secondary reproductive…

Q: searcher has made a UAS transgenic line that drives a muscle transcription factor is attached to GFP…

A: Recessive character is only expressed in homozygous condition where as dominant character is…

Q: Both graphs represent different population growth models. the maximum rate of adaptation the maximum…

A: The growth chart has four different phases which are as lag phase , log face , stationary phase and…

Q: Use the following information to answer the question: Many species of food crops have been…

A: Organisms and their environments are inextricably linked and interdependent. Every alteration in the…

Q: When you examine the phenotype of wings - why can you conclude that wings & flight are analogous…

A: Change in visible characteristics of an organism which takes place from many generations is called…

Q: Answer the following questions, with the assumption that Spongebob Squarepants is indeed a member of…

A: Ans 3- Osculum (pleural -oscula) is an excretory structure in living sponge. It's  a large opening…

Q: Which of the following is the NOT the correct way of writing the scientific name? After the…

A: 1) There are precise conventions to follow while writing a scientific name. The genus name is…

Q: Examine the table showing the classification of four questions. Taxon Domain Kingdom Phylum Class…

A: Classification is the process of grouping things together based on shared characteristics. In…

Q: 1. =lemg/ The order is for 200 mg. The label reads 250 mg/5ml. You would give ml The order is for…

A: Given: Order for 200 mg, Label: 250 mg/5ml. To Find: Amount in ml.Given: Order for 500 mg, Label: 1…

Q: nswer any three.

A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Which of the following changes or mutations can be acted upon by natural selection? For each choice,…

A: Evolution is the gradual accumulation of changes in organisms over a period of time. The theory of…

Q: Help please let me answer

A: We know that Lymphatic vessels are a network of capillaries and a huge network of tubes that move…

Q: Which of the following describes an adult who was most likely raised by an authoritarian parenting…

A: Parenting with authority is really strict. Parents want their children to adhere to the rules…

Q: Zebras (Equus quagga) are a grazing species found in the African wilderness. They are also prey for…

A: Ecology is the scientific study of the interactions between living organisms and their environment.…

Q: The anole lizard is a tree-dwelling reptile that has adapted to live almost anywhere. Because the…

A: The Dactyloidae family of lizards includes the diverse group of lizards known as anoles. They are…

Q: Please answer both, thank you

A: During gastulation of embryonic development the process of formation of neural tube  is called…

Q: 1. Divide orchiopexy into its two word parts and give the meaning of each word part. Meaning Word…

A: Orchiopexy: The undescended testicles do not cause pain, but they may cause swelling or a lump in…

Q: 13 Which of the following helps to maintain homeostasis in a human? Chemical messengers secreted by…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 4. What are some of the limitations of karyotyping? 5. Define trisomy. Define monosomy. 6. Define…

A: Genetics involves inheritance, characteristics, DNA, genes, proteins, and chromosomes. Everyone…

Q: Choose an invasive species that humans introduced to an ecosystem. Describe how the invasive species…

A: The Nile perch is native to the Nile River and was intentionally introduced into Lake Victoria in…

Q: А. В. C С. H A A D. B Е. D. E

A: The heart is a muscular body organ that is also a vital component of the cardiovascular system of…

Q: Which of the following would be considered part of an emerald tree boa's ecological niche? Select…

A: An ecological niche refers to the specific role or position that a species occupies within its…

Q: D) The concentration of this ion and negatively charged proteins is much greater inside the cell…

A: The Neuron's membrane consists of sodium to be present in large quantity in the extracellular part…

Q: Using the first C=C (i.e. 5 and 4) bond in each of the polyunsaturated fatty acids EPA…

A: Double bonds are introduced between carbon atoms during the production of polyunsaturated fatty…

Q: 2. (A) What is the name of the key orexigenic neurons in the arcuate nucleus ARC. (B) These neurons…

A: The central nervous system (CNS) is one of the two major divisions of the nervous system. It…

Q: Which of the following is not true of diabetic retinopathy? retina blood vessels swell blood glucose…

A: Answer 1 Option C is correct :  Higher than normal HDL cholestrol levels

Q: According to your textbook, considerable body of evidence link added dietary sugar to…

A: Carbohydrates are the macromolecules consisting of carbon, hydrogen and oxygen as the key elements.…

Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…

A: Water  It is the most important material on the planet eart. Water makes life possible as almost…

Q: Please answer both, thank you

A: Cell-cell adhesion is the process by which cells attach to and interact with each other through the…

Q: What are some recommendations to clinicians interested in incorporating body composition methods in…

A: Introduction :- Body composition means that the chemical compounds that makes up the human body , in…

Q: One of the biggest obstacles to the widespread use of ultrasound for body composition estimation in…

A: Impedance is defined as the resistance to current flow. The bioimpedance devices/techniques employ…

Q: What organism did Vries used as evidence to prove that species did change as Darwin said? * evening…

A: Question number 1 On the basis of above observations, Hugo de Vries (1901) put forward a theory of…

Q: 11. The statistical study of populations including sex ratio, age structure, and predicting growin…

A: 11)  the statistical study of populations including sex ratio, age structure and predicting growth…

Q: Imagine there are two species of skunk occupying the same niche. They are competing for the same…

A: The competitive exclusion principle also known as Gauses Law states that when two or more species…

Q: 2. The molecule shown here acts as a competitive inhibitor a of a citric acid cycle enzyme. Which…

A: The citric acid cycle is also considered as the metabolic pathway, which results in the formation of…

Q: Match the molecule with the correct geometry. Unit A page- 18 - Chemistry 20 38. tetrahedral 1…

A: Molecular geometry, also known as the molecular structure, is the three-dimensional structure or…

Q: DNA = CGC AAA CTA AGC TAC ACT AGC GTT TTA ATT MRNA = TRNA = %3D

A: Central dogma DNA is the deoxyribonucleic acid and is the basic hereditary molecule of all…

Q: DIRECTIONS: 1. On the cholesterol molecule, label the region that would be embedded in the membrane…

A: Note: As per the Bartleby guidelines I am answering the first three questions, please ask others…

Q: Question 6 Some individual white clover (Trifolium repens) plants can produce cyanide sugars, while…

A: Cyanide sugar is a trait which is controlled by two alleles of a single gene i.e. C and N.  genotype…

Q: D Question 4 Which mass extinction led to the disappearance of the dinosaurs? O Triassic O…

A: The recurrent rise and disintegration of ice sheets and glaciers driven by the Milankovitch cycles,…

Reproductive system infection

The biological process through which parents produce new children is called reproduction. A reproductive system is a group of internal and external organs that collaborate to allow males and females to reproduce. Many experts believe that the reproductive system is one of the most important systems in the body due to its crucial function in the survival of the species. Among the body's basic systems, the reproductive tract is the one that differs the most between sexes, and it is also the only one that does not operate until puberty.