C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence.For example,if input sequence is:AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAAthennumOccurrences("AGAT", sequence) should return 5numOccurrences("TATC", sequence) should return 8if input sequence is:AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATGthennumOccurrences("AATG", sequence) should return 7numOccurrences("TATC", sequence) should return 4if input sequence is:CAGATAGATAGATAGATAGATAGATGTCACAGGGATGCTGAGGGCTGCTTCGTACGTACTCCTGATTTCGGGGATCGCTGACACTAATGCGTGCGAGCGGATCGATCTCTATCTATCTATCTATCTATCCTATAGCATAGACATCCAGATAGATAGATCthennumOccurrences("AGATC", sequence) should return 1

1. Include necessary libraries: - `iostream`: for input and output operations. - `string`: for…

Answered: C++ Code: DNA Sequence The main()…

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Question

C++ Code: DNA Sequence

The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence.

For example,

if input sequence is:

AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA

then

numOccurrences("AGAT", sequence) should return 5
numOccurrences("TATC", sequence) should return 8

if input sequence is:

AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG

then

numOccurrences("AATG", sequence) should return 7
numOccurrences("TATC", sequence) should return 4

if input sequence is:

CAGATAGATAGATAGATAGATAGATGTCACAGGGATGCTGAGGGCTGCTTCGTACGTACTCCTGATTTCGGGGATCGCTGACACTAATGCGTGCGAGCGGATCGATCTCTATCTATCTATCTATCTATCCTATAGCATAGACATCCAGATAGATAGATC

then

numOccurrences("AGATC", sequence) should return 1

Expert Solution

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions