C++ Code: DNA Sequence  The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is: CAGATAGATAGATAGATAGATAGATGTCACAGGGATGCTGAGGGCTGCTTCGTACGTACTCCTGATTTCGGGGATCGCTGACACTAATGCGTGCGAGCGGATCGATCTCTATCTATCTATCTATCTATCCTATAGCATAGACATCCAGATAGATAGATC then numOccurrences("AGATC", sequence) should return 1

Q: // write a function that takes the input string and reverses it // example // argument: Hello //…

A: As per our company's policy, we are supposed to answer only the first question. However, I have…

Q: Write the following code in C++ DESIGN and IMPLEMENT a short program that will: Allow the user to…

A: #include<iostream> using namespace std; int main(){     string str;        int…

Q: Write a function called count_vowels that accepts a string argument that represents a word and…

A: Code: #required function def count_vowels(s):   #list to store vowels   vowels = ["a", "e", "i",…

Q: In C++, Write a function that receives a string of characters and return true if the string is in…

A: A program is to be written in a C++ language. The program can be compiled on any one of the online…

Q: C++ Format Please Write a function called SortByUpper, that takes a vector of strings and changes…

A: Explanation: The vector is sorted by comparing second element of every row. We are assuming that the…

Q: In c++ is it possible to assign a string with two separate values?

A: Solution:-

Q: Write a function int count_vowels(string sentence) that returns a count of all vowels in the string…

A: Answer :

Q: Write a function that accep should count the number of

A: Dear Student, The required code along with code implementation and expected output is given below -

Q: remove_substring_from_string(s, substr): This function takes two strings s and substr as input. It…

A: PROGRAM CODE: # start definition of function to remove substringdef remove_substring_from_string(s,…

Q: longest.py -> using sys.argv ● Create a program, longest.py, that has a function that takes one…

A: Need to provide python code that has a function that takes one string argument and prints a sentence…

Q: A string is given that contains digits only. Write a C++ function that takes a string as the…

A: Given: A string is given that contains digits only.  Requirement: Write a C++ function that takes a…

Q: Given an alphanumeric string taken input from user. Your task is to write a program that prints the…

A: Traverse the given string and count the number of digits in the string. For checking digits, the…

Q: clean Write a function clean that when is given a string and returns the string with the leading and…

A: def clean(s): # Initialize pointers for start and end of non-space characters start = 0 end…

Q: Write a function reverse which takes a string as an argument, reverses the string and returns a new…

A: Code

Q: Write a function that gets two strings, str1 and str2, and searches for str2 inside str1, and…

A: The function str_find() first check if str2 is present in str1 using in-built function strstr(). If…

Q: In C language, implement the function that gets a string str, changes all digits of str to 0 (zero),…

A: To implement a function in C that will convert all numbers in a string to 0 and count the converted…

Q: Please Help C++ Write a function that returns an integer and accepts a pointer to a C-string as an…

A: Here is the c++ code: See below step for code.

Q: Write a small application to maintain contact information about people. For each person in your…

A: used to create computer programs. An example program of C++ is : #include <iostream> using…

Q: Homework 10-1 Programming Challenge: 2 - Backwards String Write a function that accepts a string…

A: Solution:   Given, Write a function that accepts a string and returns a string in which the…

Q: In C++: Define a function that reads input 5 integers from the user, stores them in a vector, and…

A: Define a C++ function that reads input 5 integers from the user, stores them in a vector, and then…