Both plasma and Plasma Serum serum Depleted of cells and cell remnants Fibrinogen is absent Anti-coagulant is needed

Q: Nursing duties for a patient who is colorblind?

A: A person may have deficient or poor color vision and is unable to see the differences in certain…

Q: Please explain the different types of dialysis and how they are used.

A: As we know Dialysis is the process of artificial purification of the blood of the body or in the…

Q: What will Amy include when organizing her experiential resume Which was the negative? Which were the…

A: When preparing or organizing a resume or curriculum vitae,it is always best to include the positives…

Q: ER 1ZER TIZER GEL

A: Neurons or nerve cells form the structural and functional unit of the brain and spinal cord. Neurons…

Q: How anti D drugs given?

A: Anti-D drugs are Rh incompatibility. It works by binding to Rhesus D antigen present on red blood…

Q: PRODUCTS, IS A SOURCE OF PECTIN SUBSTANCES 1. milk 2. apple, plum 3. bakery products and cereals 4.…

A: Pectin is a polysaccharide present mainly in the cell walls and non woody parts of terrestrial…

Q: VL Illustrate the given type of epithelium and give at least 2 common locations where it can be…

A: Many cell combined to form tissues . Tissues are divided into :-  A ) Epithelial tissue  B ) Nervous…

Q: What is the blood cancer

A: Blood is produced in Bone marrow ( Spongy tissue inside the bone), Bone marrow produces 3 types of…

Q: Please help me with the attached

A: The words are highlighted below in different colors,

Q: Skilk Check diglhe dliill jS-al 10 LOOK a De mage ana marcn me mmper KO me corecCE TISSUE type.…

A: A group of cells containing similar structures and functions is known as tissues. It is the shape…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: mr k's diagnosis has aphasia and hemiparesis mr k is higher rick for falls what three safety…

A: A language problem called aphasia impairs a person's capacity for efficient communication. It may…

Q: need information about the Adermatoglyphics condition I have a homework that I need to do and I…

A: Introduction: Dermatoglyphics is the scientific study of the skin ridge patterns on the fingers,…

Q: Can you please help me with a care plan on a patient with G tube

A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science

Q: Is there any way to prevent radiation exposure for people working in the radioactive field to slow…

A: Aplastic anemia develops as a result of bone marrow damage.  The damage may be present at birth or…

Q: disease this patient suffer from

A: Stroke is a medical condition in which cells die when there is insufficient blood flow to the brain.…

Q: Br2 COOH CCl4

A: b.

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: ase Label and name?

A: The respiratory system consists of respiratory organs. The respiratory tract is the passageway via…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: - List the 4 MAIN tissues found in the body.

A: Hello! Since you have posted multiple questions, we are answering the first question only. Kindly…

Q: If my gay boyfriend has HIV positive that he suck my dick. Am I get a change catch HIV positive?

A: HIV stands for Human Immunodeficiency virus. It is a group of retrovirus that can infect humans. Its…

Q: You are having a difficult shift. You report to Mrs. Moskowitz's room. As part of the pleasantries…

A: I am having a difficult shift. I report to Mrs. Moskowitz's room. As part of the pleasantries I…

Q: Part IV – Late Stage Complications After Jamie's visit with the rheumatologist, she was treated with…

A: Cardiac indicators or cardiac enzymes or cardiac biomarkers are myoglobin, troponin, creatine…

Q: I am confused what is HDI. pls define in easy words.

A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…

Q: Quantal release can occur spontaneously O True O False

A: Quantal release refers to the neurotransmitter released from the vesicles. This is mainly used for…

Q: tify the b x provide TAHBS

A: The fluid filled spaces which are present inside the body and perform the function of holding and…

Q: Can you talk to me about the survival and prognosis of tuberculosis please?

A: Tuberculosis The bacteria Mycobacterium tuberculosis causes this disease. The disease affects…

Q: A drug company is developing a new pregnancy-test kit for use on an outpatient basis. The company…

A: PV+ value refers to the positive predictive value in a test for a disease. It can be calculated…

Q: Language and verbal skills tend to be side of the brain of right-handed people. concentrated on the…

A: The brain is one of two components (the other being the spinal cord) that is the epicenter of the…

Q: What is the Fischer projection of the nonulose structure above? H OH H OH HOH HOH H OH HOH H OH HOH…

A: The fischer projection of given nonulose structure is..  fischer projection is 2-D image of 3-D…

Q: What is Scarlett fever

A: Scarlet fever is a bacterial illness that can cause a rash and fever. It is most common in children,…

Q: can you suggesst treatment

A: A common electrolyte problem is hypernatremia, which is defined as a rise in serum sodium content to…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Headache is a symptom  What could be a sign for a patient with a headache?

A: Whether it be a stressful situation, lack of sleep or the sounds of the construction work nearby…

Q: Can u answer your qustions

A: Need to find the answers the given questions below with reference to the graph.

Q: General charecters and Lap diagnosis of gooze parvo-virus ?

A: Introduction  Viruses are microscopic infectious agents that can infect and multiply within the…

Q: CH OH CH -Q OH HHHHHHHHH CH CH C-C-C-C-C-C-C-C-C-C-H HO H. HHHHHHHHH CH-CH OH H. H. OH OH H

A: Biomolecules are substances that are present in living beings. The biomolecules are formed of…

Q: Q:What is Menkes disease? Give a brief explanation.

A: Menke's disease is an inherited x-linked recessive disorder that is caused by mutations in gene…

Q: im confused, what is the answer?

A: The root system and the shoot system are the two main structures in plants. Every one of these…

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.