A replication bubble is shown below, with the origin of replication represented by a black dot. 5' A 3' 3' 5' C D On which segment(s) will the DNA polymerase Ill travel towards the origin of replication? Select all that apply. OA

A replication bubble is shown below, with the origin of replication represented by a black dot. 5' A 3' 3' 5' C D On which segment(s) will the DNA polymerase Ill travel towards the origin of replication? Select all that apply. OA

Name: 14 A replication bubble is shown below, with the origin of replication
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 14 A replication bubble is shown below, with the origin of replication represented by ablack dot.5'A3'3'5'CDOn which segment(s) will the DNA polymerase Ill travel towards the origin ofreplication? Select all that apply.OA

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…
Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show the specific DNA sequences that is essential for replication function scattering over a 245 base pair of Oric region.
5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two strands will have a continuous replication? 7. Which is the lagging strand? 8. Along which strand will Okazaki fragments appear? 9. How are Okazaki fragments joined together? 10. Where should the 3' end of the lagging strand be located? On the right or left side? in
In the following diagram of a replication fork, primers are shown as thick black lines and newly synthesized DNA is shown as squiggly lines. Enzymes are shown as circles or boxes. Click on DNA polymerase I 3' 5' 7 c 34 % G Search or type URL 3' MacBook Pro & 5' + (: * II in 3 5' 3' +
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.
Below is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?
3 E D C The arrow in the diagram below indicates the direction of movement of the replication fork. 5' S R F Q Search Which letter indicates a strand that is synthesized discontinuously? OA Ов ос V A F5 T C G B F6 T 6 Replication B LDL Y F7 H & 7 WALLS U N F8 * 00 99+ 8 J₁ F9 kirimmi MO 35 Alt מם E K 2 F10 L P < F12 10:05 AM 4/8/2023 Ctrl 10 B
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA Replication fork A [ [ Choose ] [ [ Choose ] [ [ Choose ] D [ [ Choose ] E [ [ Choose ] > > > > B.
Match the statement to the corresponding agent/key player in DNA replication. Some items require more than one answer. choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I RNAse H Flap 1 DNA gyrase Pol α DNA helicase Primase Single chromosome Multiple points in chromosomes DNA ligase Not applicable Origin of replication in eukaryotes Adds more nucleotides in the lagging strand of eukaryotes Origin of replication in prokaryotes Adds more nucleotides in the leading strand of eukaryotes Lessens the tension of supercoiling Adds more nucleotides in the leading strand of prokaryotes Dissociates after adding the few initial nucleotides in prokaryotes Holds the processive enzyme in eukaryotes Breaks the H-bonds of bases Adds more nucleotides in the lagging strand of prokaryotes
Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'