Below is a piece of DNA, and under that in BOLD is the RNA that was produced from that DNA. 5'AGCGCTATGCTGCAATGCTGCCAGCATGTCTGATTAAGCCCTGACTGGCTGCTGACTTGATCGTATG 3' 3'TCGCGATACGACGTTACGACGGTCGTACAGACTAATTCGGGACTGACCGACGACTGAACTAGCATAC 5' 5' UGCUGCCAGCAUGUCUGAUUCUGACUGGCUGCUGACUUGAUCGUAUAAGCCG 3' On the DNA strand label The template strand and the coding strand The promoter region The +1 site The intron On the mRNA label The 5' UTR The 3' UTR Translate the protein

Q: 32 外 外 13 11

A: This image is showing the inferior view of the skull.

Q: Hello, I'm not following the last question here. Please help.

A: Vasopression is also called anti diuretic hormone.It is a hormone synthesized from the AVP gene as a…

Q: What made the statement wrong?

A: Answer :- Yes , the restriction cloning process, both the plasmid and the DNA sequence of interest…

Q: A -J B -E -K

A: In most vertebrate animals, a bone is a hard tissue that forms part of the skeleton. Bones protect…

Q: dieting and exercising or should

A: Introduction:- The digestive system helps to absorb the food and eliminate the waste products from…

Q: Please help me answer this question

A: A compound of hydrogen and carbon, such as any of those which are the chief components of petroleum…

Q: a) What type of molecule is this? b) How do you know? c) Describe the variety of larger molecules…

A: Molecules are of various types. They can be organic or inorganic.

Q: what did percy lavon julian do (add pictures please)

A: Medicines are designed to treat illnesses and medical conditions. They help to alleviate symptoms,…

Q: i don't understand someone help

A: Food chain is a linear flow of food or energy through an ecosystem from producers to the…

Q: Can you send me the website or where you got this information so I can read further please

A: Photosynthesis and cellular respiration are two of the vital biochemical processes that are…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: Can someone help me plz

A: Photosynthesis is the process by which green plants and certain other organisms transform light…

Q: are there any other methods you can also use?

A: There are several methods to determine whether a gene is expressed or not. Here are some commonly…

Q: Are the physicians required to co-sign PA or NP documentation ?

A: Nurse practitioners and physician assistants both receive considerable education and training in…

Q: Incomplete answers did not answer 5 questio ns

A: In a given condition patient is suffering from bilateral pain so the doctor prescribed her NSAIDs.…

Q: Mary O'Keefe calls the Inner City Health Care office in a panic. Gwen Carr, CMA (AAMA), answers the…

A: Electrocution is defined as death that occurs mainly by electric shock, either deliberate or…

Q: Could you help me with the punnett square?

A: A Punnett square is a visual tool used in genetics to predict the outcomes of a cross between…