Before a cell divides, it duplicates its DNA in a process called molecule unzips into two strands that serve as templates. The enzyme DNA During this process, the DNA joins individual to the original DNA strands following
Q: DNA is a chemical that cells use to store information. Describe how information is encoded in DNA,…
A: DNA is Deoxyribo Nucleic Acid which is a complex molecule which consists of two polynucleotide…
Q: Q5
A: Introduction Mutation: any changes in the sequence in the genetic material which leads to disorders…
Q: The synthesis of new DNA requires energy. Where does this needed energy come from? The DNA…
A: DNA polymerases are the enzyme that replicate DNA in cells. DNA polymerase can not create new strand…
Q: Replication of DNA begins at and transcription of RNA begins at
A: In DNA replication the double-stranded molecule of DNA is copied for making two identical DNA…
Q: The process by which the genetic code of DNA is copied into a strand of RNA is called O translation…
A: Since we answer the first question in case of multiple questions. If you want any specific question…
Q: If a DNA strand has the sequence ATGCGATCCGC thenthe sequence on the complementary DNA strand is…
A: Answer is b.) TACGCTAGGCG.
Q: The Structures of Genetic Material • DNA is made up of called a • DNA is made up of consisting of 3…
A: Deoxyribonuclic acid (DNA) is an organic molecule or compaund, which contains genetic information as…
Q: Which of the following processes is a part of protein synthesis and is NOT affected by a silent…
A: Introduction DNA is a self replicating molecule. During DNA replication each strand of DNA acts as a…
Q: DNA can copy itself through a process known as _____.
A:
Q: Whole DNA chromosomes are kept in the nucleus while small nucleotide monomers move into and out of…
A:
Q: DNA is a large molecule and is wrapped around proteins called: O a. Histones O b. Ligase O c.…
A: DNA (deoxyribonucleic acid) is the molecule that conveys genetic information for an organism's…
Q: You have designed a drug to stop the DNA replication process in cancerous cells. Explain how your…
A: The cell division process is a highly controlled mechanism that divides a cell into two daughter…
Q: Before a cell divides, it duplicates its DNA in a process called Replication molecule unzips into…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: Fill in the blank with the most appropriate term that is described by the following statement:…
A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…
Q: True or False: Enzymes known as DNA polymerase assemble new DNA strands into a proper base sequence…
A: True
Q: The template for protein synthesis is: the DNA template strand an mRNA strand a protein primer O the…
A: Introduction: The term 'Genetic code' is coined by George Gamow which consists of a sequence of…
Q: enzyme called________ lats down the initial short piece of template RNA.
A: In Prokaryotes, During DNA replication the first step is to unwound the ds DNA and here the enzyme…
Q: mRNA comes from the ______________ and goes to the __________________. a. DNA, Ribosome b. DNA, RNA…
A: Step 1 RNA or ribonucleic acid is a single-stranded mixed polymer of four types of ribonucleotides,…
Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal ______________…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: Which statement about DNA clamps is TRUE? OThey prime synthesis of DNA. They form ends of eukaryotic…
A: The clamp protein actually helps in the binding of DNA polymerases during DNA replication.
Q: Makes a DNA copy from a piece of RNA [Choose ] Reverse Transcriptase
A: In the method of Reverse Transcription ( RNA dependent DNA polymerase) convert Ribo nucleic acid…
Q: DNA replication results in the creation of _____________ identical strands of DNA.
A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…
Q: An enzyme called _____________________ catalyzes theformation of a covalent phosphodiester bond…
A: DNA replication is the process of formation of complementary strands of DNA molecules from the…
Q: Molecule involved in joining segmented nucleotide strands is... O a. DNA ligase b. Ribosomes c. RNA…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: The enzyme known as ________ uses ________ and separates the DNA strands at the replication fork. a.…
A: DNA Replication is the biological process of generating exact copies of DNA from the original DNA…
Q: DNA replication is semi-conservative and results in each new cell receiving a copy composed of 1 new…
A: DNA or deoxyribonucleic acid is the biomolecule that carries the genetic information in a coded form…
Q: Classify each description as a property of DNA only, RNA only, or both DNA and RNA. DNA only RNA…
A: DNA is the genetic material which resides in nucleus. So, they are passed from existing cells to new…
Q: During DNA Replication, _____________ is synthesized in a series of short pieces called…
A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…
Q: Adds nucleotides in the 5' to 3' direction during DNA replication.
A: The biological process of making two identical DNA copies from a single original DNA molecule is…
Q: The enzymes responsible for forming the final phosphoiester bond between two DNA fragments during…
A: The phosphodiester bonds constitute the backbone of the strands of DNA.
Q: DNA is used to make and RNA is used to make RNA, proteins RNA, DNA Proteins, DNA Extra DNA, TRNA
A: *The answer of the question is option 1 that is RNA and Proteins. * DNA is used to make RNA and RNA…
Q: Ribosome is where the Process of translation takes place Process of moving DNA to the cytoplasm…
A: Ribosomes are made up of both proteins and RNA. These are a part of translational machinery present…
Q: DNA synthesis always occurs starting at the _____________ end and moving toward the ______ end.
A: DNA polymerases can add deoxyribonucleotides only to the 3' end of a growing DNA chain.
Q: . DNA synthesis begins at specific nucleotide sequences, called leading strand, and proceeds in…
A: False DNA synthesis starts at a specific place on a chromosome called an origin of replication.It…
Q: What happens to the RNA primers found in newly synthesized DNA? Their nucleotides are converted to…
A: The making of DNA offspring from the parental DNA was termed DNA replication. During replication,…
Q: In cells, long pieces of DNA are organized into individual units called Select one: O a.…
A: DNA is a double helix structure that contains all the genetic information of the organism. As the…
Q: An enzyme that makes covalent bonds between nucleotide sequences in DNA is: O A) RNA polymeraco
A: DNA ( Deoxyribonucleic acid ) is made up of two anti parallel polynuceotide chains which coil around…
Q: Before a cell divides, it duplicates its DNA in a process called Replication. During this process,…
A: DNA replication can be defined as a biological process by which two identical copies of DNA are…
Q: Transcription is the process by which a complementary mRNA strand is produced from one of the DNA…
A: Ans:- Complementory mRNA strand is G-A-U-G-C-U-U-G-A-C-U-G-C
Q: DNA polymerase starts adding new nucleotide at an RNA______________.
A: For the mechanism of replication of DNA, DNA polymerase is responsible, since two similar DNA…
Q: The chemical combination of ribose and one of the phosphate group results in formation of a…
A: Nucleotides in a cell are known as the building blocks. Their functions entail cell signalling,…
Q: The __________ strand is made in fragments called ___________.
A: Semi-conservative replication, also known as DNA replication, is a biological mechanism that…
Q: The ______________ is where DNA replication begins
A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…
Q: DNA polymerase knows what nucleotide add next because it reads the ______________ strand.
A: DNA can add nucleotide to the end of 3rd strane only.
Q: Choose the combination of answers that most accurately completes the statement.As a general rule,…
A: Genetic code is the sequence of triplet nucleotide sequence that was present on mRNA molecule. These…
Q: The molecule is responsible for bringing the code from DNA to the ribosome during protein synthesis.
A: Ans. The messenger RNA (mRNA), in molecular biology, is a single-stranded RNA molecule that matches…
Q: The code on a DNA strand reads G C G T A A T G A. The mRNA strand would read:
A: Given: The code on a DNA strand reads GCGTAATGA.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letterSecond letter U A G UUU Phe UUC, U UUA UCU) UCC UCA UAU UAC FTyr UGU] UGCCYS UUG FLeu UCG, Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CAU 1 CGU CGC Arg CUU CCU His CÁC S САА CỤC ССС Leu Pro CỦA ССА CGA CUG CCG CAG GIn CGG AAU LAsn AGU ], AUU ACU* AUC }ile A AUA АСC АСА ААС AAA Ser AGC. AGA Thr JArg AUG Met ACG AAG FLys AGG GAU ASP GACS GAA GAGJ Giu GGG) GUU GUC - Val GUA GCU] GCC GGU GGC Ala Gly GCA GGA Glu GUG GCG Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAАTTTAAATTT -3' Template strand 3'- АТАСТТТАААТТТАAA — 5' а. What are the amino acid sequences encoded peptides by the three possible reading frames? Please write your answer like this: Pro-His-Stop-Leu etc. Reading frame 1 starts with the first 5' nucleotide. ORF1: Enter your answer here ORF2: Enter your answer here ORF3: Enter…Plsssssssss helppppppp
- Hii, can anyone help me with this. Your help would be very much appreciated, thank youuu.Linl F O Schoology StudentVIJE vbschools schoology.comoranior essessmer delverystart/31548043512ac1onoLrestmez O Schoology It e Elemental - Ele. Sae DEsmos | Testing Play Kahoot! - Ente. Bayside Home Page Schoology Bayside Home Page Catalase is an enzyme that speeds up the decomposition of hydrogen peroxide (H2O2) into water and oxygen. Students conducted two investigations to determine the ideal conditions for the function of catalase. One investigation compared catalase activity at different values of pH. The other investigation compared catalase activity at different temperatures. Enzyme Activity vs pH Enzyme Activity vs Temperature 3 5 11 10 20 30 40 50 pH Temperature ("C) According to the data in the graphs, which pH and temperature combination provides the BEST conditions for catalase to function? O pH 5 and 4 c O pH5 and 25'C O pH 7 and 37 C O pH 7 and 50°C Relative Enzyme Activity Activityон он он OH HOH2C. CH2OH он бн бн ÕH ÕH
- Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile – Tyr – Lys – Asp mRNA sequence (5’-3’)AUG – AAC – UGU – UUU – GAA – AUG – CUU – CGU – AUU – GAU – GAA – GGU – CUU – CGU – CUU – AAA – AUU – UAU – AAA – GAU - Write the dsDNA that encodes for this peptideCan someone help me ?All answe give me