B. DIRECTIONS: Read each statement carefully, Write TRUÚE if the statement is correct. If it is false CHANGE the underlined word/s to make the statement correct. Write your answers on a separate sheet of paper. 1. North American Plate shares boundaries with the African, Australian, Pacific, and South American Plate. 2. The tectonic plate is also known as the lithospheric plate. 3. Oceanic crust is denser than continental crust, 4. The scientists used fossils as a basis for identifying the major tectonic plates. 5. One of the major plates that combine two (2) plates is the Australian plate,

Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…

A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…

Q: 17 Match the number of the label in the diagram below with the appropriate site or structure from…

A: Electron transport chain Also called the ETC is composed of four protein complexes. These protein…

Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…

A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…

Q: Part 1: Graphing Biotic Potential 1. Make a table to show the data (# flies/generation). for one…

A: Given that one female fly can produce 120 eggs in one generation. Of these 120 eggs, half (60) will…

Q: A biologist gathered data to show the interaction of the golden-cheeked warbler and juniper tree…

A: It is given that the bar colored in light grey gives the number of juniper tree person acre and the…

Q: How would the immediate loss of ATP likely influence the delivery of uncoated vesicles to their…

A: Answer of the question is option "C" Vesicle transport is the way of transport protein in…

Q: Please read the prompt and answer question 4 and answer ALL its subquestions. Please mind the word…

A: The breakdown of the large food molecules which are insoluble into water soluble food molecules to…

Q: Q1.32. In the terrestrial phosphorus cycle illustrated below, at what rate is the size of the plant…

A: Phosphorous is introduced into soil by the weathering of rocks. The soluble phosphorous is then…

Q: 22) If both married couples have the sickle cell trait (AS), what is the possible combination of…

A: The mode of inheritance is a pattern of obtaining parentral alleles  or genes to the offsprings. The…

Q: The photomicrograph below shows mitotically dividing cells from whitefish (Coregonus lavaretus). a.…

A: Mitotic division: it is also known as equal division because each daughter cells have a copy of…

Q: searcher has made a UAS transgenic line that drives a muscle transcription factor is attached to GFP…

A: Recessive character is only expressed in homozygous condition where as dominant character is…

Q: Punnett Square a What is the percent chance the offspring will be green? 0% Gg 100% 99 25% Privacy…

A: A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: When you examine the phenotype of wings - why can you conclude that wings & flight are analogous…

A: Change in visible characteristics of an organism which takes place from many generations is called…

Q: According to the videos and the readings for this unit, what is true of the gut microbiome? The gut…

A: Gut microbiome are the microbiota (range of bacteria, archea and fungi ) that lives inside the gut…

Q: Answer this question asap quickly fast thanks

A: Endocrine hormones are released by the endocrine glands directly into the bloodstream. Thus,…

Q: 5)(comprehension) In double-stranded DNA, which of the following base RATIOS ALWAYS EQUALS 1?…

A: Erwin Chargaff proposed two rules which are termed as Chargaff's rule. These rules played an…

Q: Which procedure should have been performed to prevent error in this investigation?

A: The correct answer is d, Both groups should have been tested in the same soil type at each humidity…

Q: Organ Lymph nodes Tonsils 4. Thymus along the course of the lymphatic vessels 2. 5. 6. Location…

A: As per Bartleby guidelines, an expert cannot answer more questions at a time. So, kindly post other…

Q: The pKa of the HEPES buffer is 7.55. What is its effective buffering range? Any pH below 7.55 Any pH…

A: HEPES means hydroxyethyl-piperazineethane sulfonic acid. Buffers are the solutions that resist the…

Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…

A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…

Q: Examine the table showing the classification of four questions. Taxon Domain Kingdom Phylum Class…

A: Classification is the process of grouping things together based on shared characteristics. In…

Q: 1. =lemg/ The order is for 200 mg. The label reads 250 mg/5ml. You would give ml The order is for…

A: Given: Order for 200 mg, Label: 250 mg/5ml. To Find: Amount in ml.Given: Order for 500 mg, Label: 1…

Q: The Kudzu plant is an invasive species because: O It is native to East Asia but currently is found…

A: Introduction: Kudzu (also Known As Japanese Arrowroot Or Chinese Arrowroot) Is A Perennial Vine That…

Q: nswer any three.

A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: | 11. Fill in the correct answers below. e. A specific example of a carbohydrate monomer is: ANSWER…

A: Macromolecules are large, substances made up of repeating components such as carbohydrates, lipids,…

Q: 5. Active transport allows cells to maintain higher concentrations of many different molecules than…

A: Membrane transport of polar or charged species requires additional help from channels or transporter…

Q: Lactose exists in two Why?

A: Disaccharides are made up of two monosaccharides. Lactose is a disaccharide made up of glucose and…

Q: • At a pH of 12, what charged groups are present in the amino acid valine? -NH3+ -CO2- -NH2- -NH3+…

A: Aminoacids are the building blocks of protein. Each aminoacid have a central carbon and it's…

Q: 8. In the Stomach: a. Is there digestion? YES or NO b. If YES, then answer i-iv to explain. If NO,…

A: Fats are esters of fatty acids , also called as lipids/triglycerides.

Q: Identify the structures that are part of the male reproductive system. Select 2 choice(s) vas…

A: The male reproductive system includes- Penis, scrotum, testes, epididymis, vas deferens, prostrate…

Q: age) contain primarily protein and reen peppers and onions) contain

A: The breakdown of the large food molecules which are insoluble into water soluble food molecules to…

Q: Y-: yellow yy: black S-: star ss: starless All the sneetches want their children to have stars on…

A: Available data: Two autosomal diallelic genes Y and S Y is the dominant allele which expresses for…

Q: 1. Divide orchiopexy into its two word parts and give the meaning of each word part. Meaning Word…

A: Orchiopexy: The undescended testicles do not cause pain, but they may cause swelling or a lump in…

Q: - After you are finished, list each step for the Gram staining procedure. - Which of the four steps…

A: NOTE: AS PER OUR GUIDELINES WE NEED TO ONLY ATTEMPT FIRST QUESTION AND ITS PARTS , PLEASE RESUBMIT…

Q: 2. (A) What is the name of the key orexigenic neurons in the arcuate nucleus ARC. (B) These neurons…

A: The central nervous system (CNS) is one of the two major divisions of the nervous system. It…

Q: Digestion of the cheese and meat FATS: 7. In the Mouth: a. Is there digestion? YES or NO b. If YES,…

A: 7) (a) No, digestion of fats doesn't take place in the buccal cavity. In the mouth only the…

Q: Which of the following is not true of diabetic retinopathy? retina blood vessels swell blood glucose…

A: Answer 1 Option C is correct :  Higher than normal HDL cholestrol levels

Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…

A: Water  It is the most important material on the planet eart. Water makes life possible as almost…

Q: 1. Gene expression can be regulated at the level of a) transcription b) RNA stability c) translation…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: 10. Name which system each organ belongs to: Organ Organ System Name something you know about this…

A: The organisms exhibiting metabolism, cellular organisation, homeostasis,growth, reproduction ,…

Q: What are some recommendations to clinicians interested in incorporating body composition methods in…

A: Introduction :- Body composition means that the chemical compounds that makes up the human body , in…

Q: One of the biggest obstacles to the widespread use of ultrasound for body composition estimation in…

A: Impedance is defined as the resistance to current flow. The bioimpedance devices/techniques employ…