ATP yield from glycolysis, TCA cycle and oxidative phospharylation (a) Compute the theoretical ATP yield when one molecule of glucose is catabolised to pyruvate. (b) Compute the theoretical ATP yield when one molecule of glucose is completely catabolised under aerobic conditions in a muscle cell. (c) Compute the theoretical ATP yield when one molecule of glyceraldehyde is catabolised to pyruvate. (d) Compute the theoretical ATP yield when one molecule of pyruvate is completely catabolised under aerobic conditions in a muscle cell. (e) How many ATPs are obtained (by oxidative phosphorylation) from the NADH generated in the TCA cycle when one molecule of acetyl-CoA is catabolised in a muscle cell under aerobic conditions?

Q: ing to the video "Ben Goldacre: Battling Bad Science" from Assignment 5.2, which e statements is…

A: Placebo is a kind of substance which produces no medical effect. Placebo is given to create a  false…

Q: The type of skeleton in earthworms that allows it to move forward or backward_________.

A: In good soils, whether in your garden or a meadow, earthworms are common. They are slimy,…

Q: CN12 Hypoglossal

A: The twelve pairs of nerves that arise from the brain and function to connect the brain with several…

Q: Label 1 and 2 Skull only name

A: In human anatomy, the skull is a type of bone consist of twenty-two clusters of bones that form the…

Q: FLG I_ K

A: Human muscular system:The muscular system is made out of particular specialized cells known as…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: Muscle Mass and Weight Lifting OPositive O Negative O Zero

A:

Q: Label a and b asap

A: We can say that Animals are defined as a group of eukaryotic multicellular organisms where they…

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: Tissue engineering question Please give a brief and clear answer with your own words. Question:…

A:

Q: Well firm - limited smooth bulge on the hard palate of this 67 year old woman, painless so what is…

A: Introduction - Cancer is a broad term that describes a variety of disorders characterised by the…

Q: Lebel 1

A: We know that It is the largest bone in the body. It is the bone present on the upper end of the body…

Q: FAILURE TO THRIVE

A: Failure to thrive is a descriptive term and is not actually a diagnostic term. This term is used…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Classification of cancer

A: Cancer is the umbrella term for a group of diseases. Any of the body's cells begin to divide without…

Q: 17 STRE

A: Muscles of hand and arm

Q: AND PANCREAS 8. 10 11

A: The duodenum is the first section of the small intestine in most higher vertebrates. The pancreas is…

Q: Thoughts on vaccinations

A: The use of vaccinations or vaccines is essential for suppressing the spread of infectious illnesses.…

Q: sterile offspring ______________________________.

A: The biological process in which the offspring (new individuals) are produced from their parents is…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: Fibrocartilage (____×)Location _______________________ Function _______________________

A: As we know human body is made of skeleton. Skeleton is structure that keeps body in shape and helps…

Q: Loss of heterozygosity of tumor suppressor gene_______________

A: Loss of heterozygosity -It is the loss of one parent's contribution to cell and can be caused by…

Q: 7nm= _ um= _ mm

A: 1 nano meter is equal to 0.001 or 1/1000 micrometer 1 micrometer is equal to 0.001 or 1/1000 milli…

Q: 器 6 *器 S5 * ** The karyotype pictured here represents A. a normal male B. a normal female OC.a Down…

A: The representation of all the chromosomes of the cell nucleus of males or females is representation…

Q: Technique used to prep abdominal area for surgery.?

A: Preoperative preparation Proper preoperative preparation optimizes postoperative outcomes.  Routine…

Q: Part C of the question

A: The coding region of the given sequence is 109 to 285 nucleotides and 455 to 567 nucleotides. These…

Q: Label name correctly please answer

A: We know that The muscular system is formed by the muscles of the body that are soft tissues and are…

Q: why 7

A: Xylem transport is the process by which water and dissolved minerals are transported from the roots…

Q: A- Min

A: Muscles of forearm, wrist and hand are subdivided into 19 intrinsic and 24 extrinsic muscles. The…

Q: Can you answer question 6 please

A: There are beneficial bacteria in the gut,the gut microbiota contains over 3 million genes, making it…

Q: Digestive structure

A: We know that The gastrointestinal tract is an organ system of the body responsible for carrying out…

Q: Symptoms/problems for treacher Collins Syndrome

A: Treacher collins syndrome is usually a genetic disease that causes the underdeveloped facial bones.…

Q: Tissue engineering question Please give a brief and clear answer with your own words. Question:…

A: The application of scientific and technical principles to the processing of the material by…