Acetylation is the [Select) of acetyl groups ta ( Select ) Acetylation will ( Select ] the association between DNA and histones Acetylated DNA is found in ( Select ] Methylation is the [Select] v of methyl groups to ( Select] Demethylation will (Select ) the association between DNA and histones Demethylated DNA is found in (Select ) > >

Acetylation is the [Select) of acetyl groups ta ( Select ) Acetylation will ( Select ] the association between DNA and histones Acetylated DNA is found in ( Select ] Methylation is the [Select] v of methyl groups to ( Select] Demethylation will (Select ) the association between DNA and histones Demethylated DNA is found in (Select ) > >

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 16P: Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins,...

See similar textbooks

Similar questions

Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
In human DNA, 70% of cytosine residues that are followed by guanine (so-called CpG dinucleotides, where p indicates the phosphate in the phosphodiester bond between these two nucleotides) are methylated to form 5-methylcytosine. As shown in the following figure, if 5-methylcytosine should undergo spontaneous deamination, it becomes thymine. NH, Deamination NH 5-methylcytosine Thymine Methylated CpG dinucleotides are hotspots for point mutations in human DNA. Can you propose a hypothesis that explains why?
1. a specific type of histone methyltransferase catalyze the methylation of a single lysine or a single arginine in a histone protein. Draw the structures of methylated lysince and methylated arginine reside. 2. the reversal of histone arginine methylation converts the methyated arginine to citrulline in a reaction that consumes H2). Draw the resulting amino acid residue. What os the pther product of the reaction?
Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
6. H₂C HO O O T "N Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ N N NH NH C N NH N NH "N topol NH₂ Dofo HO G 01-07 HO "NH₂ NH₂ N NH, QP-C NH₂ Joy HO HO НО B C D 7. Explain the effect of the acetylation status of histones on chromatin structure and gene expression. Your answer should include the terms "heterochromatin", "euchromatin", "transcriptionally active" and "transcriptionally inactive" Dofo HO
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through c. For Mutant 1: Met-Ser-Pro 1) indicate what change has occurred at the DNA leve! 2) identify the specific type of mutation that occurred in the DNA (single base substitution, frameshift (insertion, deletion), 3) indicate the phenotypic effect of the mutation (nonsense, etc.). Show all work.
In human DNA, 70% of cytosine residues that are followed by guanine (so-called CpG dinucleotides, where p indicates the phosphate in the phosphodiester bond between these two nucleotides) are methylated to form 5-methylcytosine. As shown in the following figure, if 5-methylcytosine should undergo spontaneous deamination, it becomes thymine. 2. NH, Deamination 5-methylcytosine Thymine Methylated CpG dinucleotides are hotspots for point mutations in human DNA. Can you propose a hypothesis that explains why?
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two introns in this DNA sequence. Remember introns start with GT and end with AG. (a) How many base pairs are in intron 1 and intron 2.
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependent manner. By comparison, many other proteins do interact with nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What information do you know based onthe question…