A Python Programming in Medicine. A techy doctor from the Great Kanagawa Prefecture has become famous for his new offering of medical service, a personalized treatment of his patients that utilizes bioinformatics. By taking some samples of DNA from his patients, he uses state-of-the-art equipment to let computer collect and extract important information that can be found in the DNA sequence. Applying computational analysis on the data extracted would enable the doctor to determine more accurately his patients’ real health problems. In this scenario, you will serve as an intern in his laboratory who will be assigned an important task. You will be given a long DNA sequence, which is represented in a string of letters. Your task is to convert 3-letter codons into protein residues. The output would be the corresponding residues. INPUT: DNA sequence OUTPUT: Generated 3-letter codons and corresponding protein residues An input sample of DNA sequence would
A Python Programming in Medicine. A techy doctor from the Great Kanagawa Prefecture has become famous for his new offering of medical service, a personalized treatment of his patients that utilizes bioinformatics. By taking some samples of DNA from his patients, he uses state-of-the-art equipment to let computer collect and extract important information that can be found in the DNA sequence. Applying computational analysis on the data extracted would enable the doctor to determine more accurately his patients’ real health problems. In this scenario, you will serve as an intern in his laboratory who will be assigned an important task. You will be given a long DNA sequence, which is represented in a string of letters. Your task is to convert 3-letter codons into protein residues. The output would be the corresponding residues.
INPUT: DNA sequence
OUTPUT: Generated 3-letter codons and corresponding protein residues
An input sample of DNA sequence would look like this:
TGGTACTCTTTCTTCACAAGGGCGCCGTGTGTG
The 3-letter codons are simply every three letters in the sequence.
TGG TAC TCT TTC TTC ACA AGG GCG CCG TGT GT
Note: The sequence might not have a multiple of 3 bases. If that happens you must map the final 1- or 2-base term to asterisk, instead.
The corresponding protein residues based on generated 3-letter codons and equivalent mapping will be:
WYSFFTRAPC*
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
