A pointer variable can take the address of a memory location as its value. Read the given program. #include main() { int a = 20, b = 30, *p, *q, **r; p = &a; *p = 50; q=&b; *q = 70; r=&p; **r = 90; } printf("%d\n", a); // 1st printf statement printf("%d\n", b); // 2nd printf statement a = 20; b = 80; printf("%d\n", **r); // 3rd printf statement Answer the following three questions. 1.The output of the 1st printf statement is [Select] 2. The output of the 2nd printf statement is [Select] 3.The output of the 3rd printf statement is [Select] >

A pointer variable can take the address of a memory location as its value. Read the given program. #include main() { int a = 20, b = 30, p, q, **r; p = &a; p = 50; q=&b; q = 70; r=&p; r = 90; } printf("%d\n", a); // 1st printf statement printf("%d\n", b); // 2nd printf statement a = 20; b = 80; printf("%d\n", r); // 3rd printf statement Answer the following three questions. 1.The output of the 1st printf statement is [Select] 2. The output of the 2nd printf statement is [Select] 3.The output of the 3rd printf statement is [Select] >

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Look at the following C++ code and comment each line about how it works with pointer. int i = 33; double d = 12.88; int * iPtr = &i; double * dPtr = &d; // iPtr = &d; // dPtr = &i; // iPtr = i; // int j = 99; iPtr = &j; //
Instructions: You are strictly not allowed to use anything other than pointers and dynamic memory. One function should perform one functionality only. Task 1 Write a program in C++ that reads data from a file. Create dynamic memory according to the data. Now your task is to perform the following task. Row wise Sum Column wise Sum Diagonal wise Sum Example data.txt 4 5 1.6 10.2 33.7 99 20.5 3 44 50 96.1 2 8 9 4 74 50 99 19.1 Output: Sum row wise: 165, 191, 17, 242.1 Sum col wise: 127.6, 120.1, 228.8, 118.1, 20.5 Sum diagonal wise: Not Possible Note: You are restricted to use pointers and your function should be generic. Avoid memory wastage, memory leakage, dangling pointer. Use regrow or shrink concepts if required.
#include <iostream> #include <cmath> using namespace std; // declare functions void display_menu(); void convert_temp(); double to_celsius(double fahrenheit); double to_fahrenheit(double celsius); int main() { cout << "Convert Temperatures\n\n"; display_menu(); char again = 'y'; while (again == 'y') { convert_temp(); cout << "Convert another temperature? (y/n): "; cin >> again; cout << endl; } cout << "Bye!\n"; } // define functions void display_menu() { cout << "MENU\n" << "1. Fahrenheit to Celsius\n" << "2. Celsius to Fahrenheit\n\n"; } void convert_temp() { int option; cout << "Enter a menu option: "; cin >> option; double f = 0.0; double c = 0.0; switch (option) { case 1: cout << "Enter degrees Fahrenheit: "; cin >> f; c =…
C++ Coding: ArraysTrue and False Code function definitions for eoNum() and output(): Both eoNum() and output() are recursive functions. output() stores the even/odd value in an array. Store 0 if the element in the data array is even and store 1 if the element in the data array is odd. eoNum() displays all the values in an array to the console.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
In C write a grading program as follows.- Ask the user for the number of students and store it in an integer variable.- Create an array of floats with four rows and columns equal to the number of students storedearlier.- Initialize the array to zeros.Create a menu with the following options (use a do-while loop and repeatedly display the menu):A or a to add student info one student at a timeT or t to display class average for homeworkS or s to display class average for quizzesB or b to display class average for examsZ or z to exit program (program repeats until this exit command is entered)
C++ Array Expander -Just do everything in main and make sure you comment each step Use Pointer Notation for the function and within the function. Use a main function and return the pointer from the ArrayExpander function to main
The range of a set of values is the difference between the highest value and the lowest value in the set. Write a C/C++ program that prompts the user to enter N integer values and stores it in an array. Calculate and display the range of the values, as well as the largest and smallest values in the set. TIP: you can declare an array of size N by declaring the array after the user enters a value for N!
Create a C++ Grocery Program according to this guideline: Linked List Functions Pointers Arrays The program must have a menu layout where the user can select certain action (Select Product, View My Cart, Check-Out, etc.) You must include all kinds of drinks/beverages Implement basic error tapping IYou must include the group name of the developers with the name of each developer (a total of 4) Group Name: In-Out Group Names: Cesar Rachel Jennifer Tom
TRUE OR FALSE, C++ When passing an array to a function, you must include & in front of the array name. When passing an array to a function, you must include & in front of the array name. It is possible to have a 2-dimensional array where each row has a different number of columns. The * is called the address of operator.
In the code segment Double radius = 4.5; Const double* ptr = & radius;The ptr is constant, but the data pointed to by the pointer ptr is not constant options: True False