A female patient has presented with the following results for spirometry and plasma Po2. What is your diagnosis? (You may need to look up the normal ranges for a female). Parameter Vital Capacity FEV₁ FVC Arterial Poz Venous Po2 COPD Value 2120 ml 1450 ml 1810 ml 87 mmHg 34 mmHg O Pulmonary fibrosis O Pulmonary oedema O Methemoglobinaemia (causes a leftward shift in the oxygen-haemoglobin dissociation curve)
Q: 11) The sterilization method that is used to sterilize antibiotics: a) uses halogens b) Phenolics…
A: 11. The sterilization method typically used to sterilize antibiotics is e) Ultrafiltration. This…
Q: If from Family B, Generation V, Individual 5 were to get married to a heterozygous male, what would…
A: In the given case, the genotype of female is "ll" (lactose intolerant) and the genotype of male is…
Q: The male I-2 in the pedigree below has “hairy ears,” a trait thought to be due to a gene or genes in…
A: Y-linked inheritance also known as holandric inheritance is the inheritance of genes that are…
Q: You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10…
A: ANSWER) The amount of DNA digested can be calculated as follows: Total amount of DNA = volume x…
Q: 5' AAGACCTATATAATGACGAACGATATT 3 TTCTGGATATATTACTGCTTGCTATAA 5¹ Coding strand: Template strand: 3'
A: Untranslated regions (UTRs) are extra sequences found in mRNA that are not translated. UTRs include…
Q: In Drosophila, a female with three recessive traits, miniature wings, (m), ebony body (e) and rough…
A: Three point cross over is a calculation approach of finding the distance between two genes by taking…
Q: What is the probability of having two daughters and 1 son? Child #1 == of being XX Child #2 = -1/2…
A: We have 23 pairs (46) of chromosomes. Among these 23 pairs, 22 are autosomes and two sex…
Q: Differentiate the four classes of phylum Porifera by making a phylogenetic tree (Make your own…
A: Members of Porifera are called sponges which are multicellular eukaryotes with cellular grade of…
Q: Briefly describe Katalin Kariko’s contribution to the development of COVID-19 vaccines.
A: Dr. Katalin Karikó's research on RNA-mediated processes has as its long-term goal the production of…
Q: When making a decision, an adolescent is most likely to focus on the potential benefits of a…
A: Adolescent decision-making is a complex process that involves various factors, including cognitive…
Q: What are some important functions of fats? Choose one 1. They lower cholesterol in the body 2.…
A: The question is asking about the important functions of fats and to choose one function from the…
Q: True or False: Calcium pumps in the axon terminal exchange molecules of calcium with molecules of…
A: Neurons are the basic structural and fundamental unit of the nervous system and brain. These are…
Q: You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10…
A: Plasmid DNA is a small, circular, double-stranded DNA molecule that is commonly found in bacteria…
Q: Lamin polypeptides (nuclear lamina) form dimers in which the central α-helical regions of two…
A: The nuclear lamina, a network of intermediate filaments lining the inner surface of the nuclear…
Q: 19) The base pairs of a DNA molecule are held together by which of the following? a. hydrogen bonds…
A: DNA acts as a genetic material in almost all living organism. DNA is composed of nitrogenous bases…
Q: Differentiate extraembryonic and intraembryonic coelom in terms of location in embryos. Provide…
A: Coelom It is defined as the main body cavity present in most organisms. It is the mesodermally lined…
Q: The result of completed apoptosis of a cell is apoptotic bodies, which are numerous vesicles of the…
A: Apoptotic bodies are recognized and engulfed by specialized immune cells called phagocytes, which…
Q: 6) The autoclave desired Temperature to kill bacterial spores must be left for at least ____ in…
A: An autoclave is a device used in laboratory and medical settings to sterilize equipment, materials,…
Q: 14. In which order do the stages of photosynthesis occur? light absorption, light reactions, Calvin…
A: Photosynthesis is the synthesis of an organic compound by utilizing light energy. Organisms that…
Q: 5. If you haven't washed your hands for a while, they may be covered in bacteria (which is…
A: An operon is an unit of gene expression as well as regulation containing structural genes, a common…
Q: Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and…
A: The tau gene is a gene that encodes the Tau protein, which is predominantly expressed in neurons in…
Q: Now, this variation is not within the gene itself. It's outside the gene. In fact, it's upstream of…
A: Changes outside the gene means that these changes may alter the DNA sequence and such changes may be…
Q: Describe and differentiate the development of the membranous and cartilaginous neurocranium.
A: The portion of the skull that houses the brain is called the neurocranium. The two primary parts of…
Q: 3) What defines the atomic number of an element? a. The number of electrons. b. The number of…
A: It is the number of protons in the nucleus.
Q: What are two things you could change or add to your nighttime routine for a higher quality of sleep?
A: A quality sleep is very important to lead a healthy life. Lack of a quality sleep will lead to many…
Q: Let's use L to symbolize the allele for lactose persistence (tolerance) and I for lactose…
A: In the given case, the allele associated with lactose intolerance is recessive and the allele…
Q: 5. Cousin Carol said she was sure that Colin was suffering from lactose intoler- ance. She had the…
A: Digestion is the process of breakdown down larger molecules present in the food into smaller…
Q: Discuss the relationship between oxidation and reduction reactions and enzymes in the various…
A: Metabolic reactions are chemical reactions that occur within living cells, involving the conversion…
Q: There are no vaccines available for contagious illnesses like AIDS and malaria. Describe the reasons…
A: • The human immunodeficiency virus (HIV) is the primary cause of AIDS, also known as acquired…
Q: The scientific method is used to arrive at new knowledge, but importantly used to validate…
A: Science is the study of and knowledge about the physical world and natural laws. Science is…
Q: Explain Mendel's Law of Segregation using an example.
A: Gregor Johann Mendel (1822-1884) was an Austrian monk and botanist who is widely considered as the…
Q: Under normal conditions, an mRNA molecule that is 99 bases long will create a protein composed of: -…
A: Note: According to bartleby guidelines only first three subparts are to be answered. So please…
Q: Briefly describe the role of T-helper (TH) cells in the function of the immune system. Be sure to…
A: T-helper (TH) cells are a specialized type of white blood cell that plays a critical role in the…
Q: How could a change in the base sequence of a gene lead to a change in the phenotype of an organism?…
A: Gene expression begins with the process of transcription, in which DNA is translated into a single…
Q: 3. Compare and contrast active transport to passive transport of diffusion of molecules across the…
A: The cell membrane is a thin, flexible barrier that surrounds and protects the cell from the external…
Q: What type of inheritance is shown in the following family pedigree? Explain your answer. Note: Your…
A: There are several patterns of inheritance that describe how genetic traits are passed from parents…
Q: 79. Which of the following descriptions is correct, regarding to O-linked and N-linked glycans? (A)…
A: Polysaccharide chains made up of repeated disaccharide units are known as glycosaminoglycans (GAGs).…
Q: 27. The sympathetic nerves supply: a) The external sphincters of the gastrointestinal & urinary…
A: Nerves are specialized cells in the body that transmit signals between different parts of the body.…
Q: A B C D E F G Use the following tree to answer the question below. Which of the following trees, if…
A: A phylogenetic tree is defined as a branching diagram or tree that depicts the relationships that…
Q: What is a nosocomial infection? Explain why the urinary tract, lower respiratory tract, and give an…
A: Infectious diseases are illnesses that are caused by microorganisms like bacteria, viruses, fungi,…
Q: what tests can you run doebthe diagnosis of Salmella typhi, and what is progression of the disease,…
A: The diagnosis of Salmonella typhi infection also known as typhoid fever can be made through several…
Q: Click on the "Background" tab on the right side. Read the information and watch the videos. 1. Why…
A: The eukaryotic cell cycle is the series of events that take place in a eukaryotic cell leading to…
Q: It is required to recover active extracellular enzymes from a completed fermentation medium that…
A: In the question, it is given that: A completed fermentation medium contains active extracellular…
Q: 50) Genetic engineering is considered the new ___________ revolution in microbiology. a) genetic b)…
A: Genetic engineering also known as genetic modification or recombinant DNA technology involves…
Q: Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…
A: Non coding RNAs (ncRNAs) like as microRNAs and small interfering RNAs (siRNAs) play important roles…
Q: ou that you are full of food? ) angiotensin ) renin ) aldosterone 1) leptin -) T4 means that this…
A: Hormone is a chemical messenger which may act locally or is carried away via blood to its target…
Q: Define virulence factors and identify those of bacteria, viruses, and eukaryotic pathogens.
A: Virulence factors are biological characteristics of pathogens that enhance their ability to cause…
Q: ) Which of these are purines? a. adenine and guanine b. thymine, cytosine, and uracil c. thymine,…
A: The building blocks of DNA and RNA are called nucleotides and they are composed of nitrogenous…
Q: A Pituitary gland s and muscles O: B Mammary glands www.w C Testes or ovaries D Releasing hormones…
A: A= Growth hormone is produced by our brain's pituitary gland and governs our height, bone length…
Q: The baroreceptors that detect a change in blood flow to the brain belong to a family of receptors…
A: Baroreceptors are specialised sensory receptors found in the carotid sinuses and aortic arch of some…
Step by step
Solved in 3 steps
- Ms. B was admitted at OBW - BRTTH last April 7, 2022 at 1:20 am, cervix 1 cm dilated. Her BP was 160/100 and her pain level of 0/10. IVF of D5LR 1Lwas inserted at the right hand, regulated at 20 gtts/min. Laboratories such as Complete Blood Count (CBC) with typing, Blood Urea Nitrogen (BUN), Hepatitis BSurface Antigen (HBsAg), Creatinine, Platelet count, and Urinalysis were done to the pregnant mother. The Admitting Diagnosis was Pre-eclampsia withsuperimposed chronic hypertension, and the final diagnosis was Pre-eclampsia with severe features. Monitoring of V/S and FHT q 4hrs was ordered and done. At9:45 pm, delivered to a baby boy with AS of 8, 9. Several hours after delivery, the mother was ordered to undergo laboratory tests. The findings are normal resultsin CBC with typing, platelet count, and creatinine. Non-reactive HBsAg and high levels of BUN and oliguria in urinalysis. Upon checking the mother, she exhibitededema around her hands. The V/S of the mother is BP: 140/90 mmHg, T:…Discuss how the following values/results can be affected by keeping a blood sample (purple top) at room temperature for an extended time period. Value/Result Affect/Change MCV Hematocrit MCHC ESR WBC Count WBC MorphologyA 39-year-old man with a history of bacterial endocarditis notices numerouspinpoint hemorrhages around the orbit of his eyes (shown in the image; seearrows). What is the appropriate term used to describe this form of superficialhemorrhage. A- EcchymosisB- ErythemaC- PetechiaD- Purpura
- Ms. B was admitted at OBW - BRTTH last April 7, 2022 at 1:20 am, cervix 1 cm dilated. Her BP was 160/100 and her pain level of 0/10. IVF of D5LR 1L was inserted at the right hand, regulated at 20 gtts/min. Laboratories such as Complete Blood Count (CBC) with typing, Blood Urea Nitrogen (BUN), Hepatitis B Surface Antigen (HBsAg), Creatinine, Platelet count, and Urinalysis were done to the pregnant mother. The Admitting Diagnosis was Pre-eclampsia with superimposed chronic hypertension, and the final diagnosis was Pre-eclampsia with severe features. Monitoring of V/S and FHT q 4hrs was ordered and done. At 9:45 pm, delivered to a baby boy with AS of 8, 9. Several hours after delivery, the mother was ordered to undergo laboratory tests. The findings are normal results in CBC with typing, platelet count, and creatinine. Non-reactive HBsAg and high levels of BUN and oliguria in urinalysis. Upon checking the mother, she exhibited edema around her hands, has severe dehydration, decreased…Ms. B was admitted at OBW - BRTTH last April 7, 2022 at 1:20 am, cervix 1 cm dilated. Her BP was 160/100 and her pain level of 0/10. IVF of D5LR 1L was inserted at the right hand, regulated at 20 gtts/min. Laboratories such as Complete Blood Count (CBC) with typing, Blood Urea Nitrogen (BUN), Hepatitis B Surface Antigen (HBsAg), Creatinine, Platelet count, and Urinalysis were done to the pregnant mother. The Admitting Diagnosis was Pre-eclampsia with superimposed chronic hypertension, and the final diagnosis was Pre-eclampsia with severe features. Monitoring of V/S and FHT q 4hrs was ordered and done. At 9:45 pm, delivered to a baby boy with AS of 8, 9. Several hours after delivery, the mother was ordered to undergo laboratory tests. The findings are normal results in CBC with typing, platelet count, and creatinine. Non-reactive HBsAg and high levels of BUN and oliguria in urinalysis. Upon checking the mother, she exhibited has distended bladder and her uterus is still boggy. The V/S…Discuss how the following values/results can be affected by keeping a blood sample (purple t room temperature for an extended time period. Value/Result Affect/Change MCV Hematocrit MCHC ESR WBC Count WBC Morphology
- Ms. B was admitted at OBW - BRTTH last April 7, 2022 at 1:20 am, cervix 1 cm dilated. Her BP was 160/100 and her pain level of 0/10. IVF of D5LR 1L was inserted at the right hand, regulated at 20 gtts/min. Laboratories such as Complete Blood Count (CBC) with typing, Blood Urea Nitrogen (BUN), Hepatitis B Surface Antigen (HBsAg), Creatinine, Platelet count, and Urinalysis were done to the pregnant mother. The Admitting Diagnosis was Pre-eclampsia with superimposed chronic hypertension, and the final diagnosis was Pre-eclampsia with severe features. Monitoring of V/S and FHT q 4hrs was ordered and done. At 9:45 pm, delivered to a baby boy with AS of 8, 9. Several hours after delivery, the mother was ordered to undergo laboratory tests. The findings are normal results in CBC with typing, platelet count, and creatinine. Non-reactive HBsAg and high levels of BUN and oliguria in urinalysis. Upon checking the mother, she exhibited has severe dehydration, decreased urine output, and her uterus…A female 40 year old patient has a hematocrit of 60%, an elevated reticulocyte count, and splenomegaly. What is a possible condition this patient has? O chronic myelogenous leukemia O lymphoma O aplastic anemia O pernicious anemia O polycythemia O thrombocytopenia O septicemiaThe tissue type in this image is Be as specific as possible. < Fev LM 250x 31 of 40 -
- A 30-year-old woman arrives at the outpatient department complaining of nausea and vomiting. The patient seems to have jaundice as well. Blood and urine tests are ordered in the laboratory. The following are the results collected from the testing: • Complete Blood Count o Hemoglobin:Normal o WBCcount:Normal • Serum Bilirubin o Total:7.0mg/dL o Conjugated:6.0mg/dL • Serum Enzymes o AlanineTransaminase(ALT):330U/L o AlkalinePhosphatase(ALP):195U/L • Urinalysis o Appearance:Darkbrown o Bilirubin:Positive o Urobilinogen:Decreased ANSWER THE FOLLOWING: 1. Interpret and correlate the patient’s laboratory results. 2. Discuss the possible causes of jaundice in this patient. 3. What part of the bilirubin pathway is severely affected? Explain. 4. What other serum enzyme/s can be used to assess the patient’s condition? Explain.With the results below, do you think the patient requires a transfusion? Using current guidlines to support your answer , explain your reason. Investigation Result (normal range - female) Haematology Red cell count (x 1012/L) 4.0 (3.8 – 5.8) Haemoglobin (g/L) 123 (115 – 165) White cell count (x 109/L) 8.1 (3.6 – 11.0) neutrophils 2.9 (1.8 – 7.5) lymphocytes 4.5 (1.0 – 4.0) monocytes 0.62 (0.2 – 0.8) eosinophils 0.10 (0.1 – 0.4) basophils 0.02 (0.02 – 0.1) Platelets (x 109/L) 138 (140 – 400) Prothrombin Time (s) 20 (10 – 14) Activated Partial Thromboplastin Time (s) 45 (22 – 36) Biochemistry Serum Bilirubin (µmol/L) 50 (≤21) Serum ALP (IU/L) 300 (30 – 130) Serum AST (IU/L) 527 (≤32) Serum ALT (IU/L) 650 (10 – 35) Serum albumin (g/L) 37 (35 – 50) Urine: Microscopy Faeces: Microscopy WBC <5 per ml No Cryptosporidium seen RBC <5…A 25-year-old female presented to her 28 week antenatal appointment with the complaint of lethargy. It was noted the patient appeared pale. A full blood count was taken. Pateints HB,HCT,MCV,MCH was low but RDW was high. expalin why it is microsytic anemia and not macrosytic anemia analyse the blood film provided below. Provide a detailed diffrential diagonises refering back to blood film.
