a and b please (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form astable model Holliday junction.W 5' GATCGCАТTСТAGCCGTAАGGTCCACTGTAА 3'х 5' GTCCCАТАCGTAGCCGтAGGACATGTAсCG 3'Y 5' CGGTAСАTGTCСТАСGGCTАСААТGCGAТС 3'Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3’(b) What is branch migration?

In the above figure the sequences are arranged on the basis of complimentarity. Let's assume red…

(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTСТAGCCGTAGGTССАСТСТАА 3' x 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5' CGGTACATGTCСТАСGGCTACААTGCGATC 3' z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' (b) What is branch migration?

(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTСТAGCCGTAGGTССАСТСТАА 3' x 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5' CGGTACATGTCСТАСGGCTACААTGCGATC 3' z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' (b) What is branch migration?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

NURSING CONSIDERATIONS FOR PRETERM BABY
33 34 41 35 42 36 43 37 44 38 39 40 Mark Nielsen || ||||
where's the items e-g?
Discussion:- I what canbediscavered fiaka an endescofy
3 4 5 6 7 Blood clot (a) Frontal section Histology of the ovary. 2.
Can the O&P be completed in the office?
Lear ing Tek #4: P!CTURE ANALYSIS: Classify the picture as positive or negative feedback and explain how ieedback mechanism works in it. and explai how ieedback mechanism works in . POSITIVE/NEGATIVE FEEDBACI EXPLANATION FICTURE 1. Blood clotting Piatele Clot Fibrin Image Source: https://www.msdmanuals.com/- Imedia/manual/homeimages/hem blood clots pluggina.aif?thn=0&sc_lan 9=en Blood sugar Low Biood Supar promnles renase of Glucagon Insulin Immelin L s BicHd Sugar High Blood Sugur Image Source: https://.pinima.com/originals/5e/54/8e/5e548eb7090eb9d9 ede35475a83e7147.ipg ert 3. Thermoregulation Bady tenyeraure decreases Buty toneraliO Increases コ heling (shivering increases fleproases Image Source: https://ib.bioninja.com.au/ Media/negative- feedback med.jpeg 51 2.
Child birth What hormone is involved?
nes ion 29 A family has four children, whose blo possible blood types of the pare O A and B O B and AB and
NCP FOR PRETERM LABOR
Explain the cause of pain resulting from:a. Endometriosisb. Primary dysmenorrhea
lf a mother is scheduled for a Caesarean-section birth (i.e., the baby is removed from the womb surgically), how would this flowchart change?