A biochemist discovers new RNA polymerase activity in crude extracts of cells derived from an exotic fungus. The RNA polymerase initiates transcription only from a single, highly specialized promoter. As she purifies the polymerase, its activity declines, and the purified enzyme is completely inactive unless she adds crude extract to the reaction mixture. What could explain these observations? Contamination by small interfering RNAs (siRNAs) during purification could decrease RNA polymerase activity. The Lac repressor bound to the lac operon could block RNA polymerase activity. Proteolysis of the RNA polymerase could be responsible for loss of enzyme activity. Dissociation of factors needed for activity, such as a specificity factor, could decrease RNA polymerase activity. The purification buffers could cause the RNA polymerase to be unstable, thus decreasing enzyme activity.

Q: If the fifth Fibonacci number is 5, calculate the value of the 14th Fibonacci number. 144 233 377…

A: The objective of the question is to find the 14th Fibonacci number given that the 5th Fibonacci…

Q: **** 5.1 mmol/L M

A: Blood sugar or blood glucose are the main sugars that are found in the human blood. Diabetes is a…

Q: If the fifth Fibonacci number is 5, calculate the value of the 16th Fibonacci number. 233 377 610…

A: The objective of this question is to calculate the 16th Fibonacci number given that the fifth…

Q: What does the formula DPD = SF - TP mean?

A: The above mentioned question is related to cell membrane. It is asking the meaning of mentioned…

Q: How many moles of chlorine gas at 120. °C and 33.3 atm would occupy a vessel of 39.0 L?

A: The ideal gas law is the equation of state of a hypothetical ideal gas. It is a good approximation…

Q: dioxide (CO,). The equation below shows this reaction. CACO, → CaO + CO, Reactant Products In this…

A: This question can be solved on the basis of law of conservation of mass which says that energy or…

Q: How many moles of tungsten(VI) oxide and hydrogen were required to produce the 5.00 g of tungsten?

A: Stoichiometry is a section of chemistry that involves using relationships between reactants and/or…

Q: You have a stock vial of diclofenac (75 mg in 3 mL) and need to draw up a dose of 50 mg for your…

A: Given:Stock vial of diclofenac: 75 mg in 3 mLDesired dose: 50 mgTo find:mLs should be drawn up to…

Q: explain bohr shift?

A: Hemoglobin is a tetrameric protein that transports oxygen in the blood. The affinity of Hb for…

Q: Ammonia detoxification mechanism

A: Ammonia detoxification is the process by which ammonia (NH3) which is toxic to the cells is…

Q: what are the biological effects of ionising radiation

A: Ionizing radiations are the radiations which carries higher energy and these radiations  are able to…

Q: Approximately what amount (in Sv) of short-term exposure to radiation produces noticeable effects in…

A: Uptake of a high level of radiation over a short time may cause symptoms related to radiation…

Q: What is electroacoustic measurement?

A: Main use of hearing aid is to give proper acoustic information so that person having impairment in…

Q: What is the function of the neutralization solution?

A: DNA Neutralizing Solution is utilized for the disengagement (isolation) of plasmid DNA by soluble…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: Name the class.

A: Arthropoda is the largest animal phylum, which includes the insects. These animals are constituted…

Q: How many g of dextrose are in 3 L of D5W

A: Dextrose is a simple sugar. it is made from substance chemically identical to glucose.   it is used…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.