7. Which of the following occurs during prophase I of meiosis?A. The alignment of chromosomes to the metaphase plateInter-chromosomal recombinationB.C. The formation of chiasmataD. The separation of sister chromatidsE. The separation of homologous chromosomes

Cell division is a metabolic process takes place inside the cell . In this , parent cell splits and…

7. Which of the following occurs during prophase I of meiosis? A. The alignment of chromosomes to the metaphase plate B. Inter-chromosomal recombination C. The formation of chiasmata D. The separation of sister chromatids E. The separation of homologous chromosomes

7. Which of the following occurs during prophase I of meiosis? A. The alignment of chromosomes to the metaphase plate B. Inter-chromosomal recombination C. The formation of chiasmata D. The separation of sister chromatids E. The separation of homologous chromosomes

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter11: Meiosis: The Cellular Basis Of Sexual Reproduction

Section: Chapter Questions

Problem 3TYK: Chiasmata: a. form during metaphase II of meiosis. b. occur between two nonhomologous chromosomes....

See similar textbooks

Related questions

Q: Frogs feed on grasshoppers, and snakes feed on frogs. Thus, an increase in the number of snakes 16)…

A: The arrangement of organisms in a linear form from producer to the apex organism. The apex organism…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: 5. The following Figure for Question 5 shows a simplified Nitrogen Cycle driven entirely by…

A: Nitrogen FixationAmmonificationNitrificationDenitrificationDe-ammonification

Q: Propose a model that outlines, step-by-step, events that could reasonably generate the expression of…

A: The "Eve stripe protein" refers to a specific protein called "Even-skipped" (Eve) that is involved…

Q: Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific…

A: In the study of SV40 DNA replication, researchers have used restriction endonucleases to investigate…

Q: I was given a graphing activity. It was do with the measuring the reaction rate against…

A: Question 2- As depicted in the graph when all the points are joined in the graph, the value of…

Q: 10. What would be the result if a cell failed to express a functional signal peptidase enzyme? a.…

A: Signal peptidases are proteins which cleave the signal peptides from their N-termini to transform…

Q: 6. A cell that has a fully replicated genome with no DNA damage will enter which phase? A. The G₁…

A: The cell cycle is an intricately regulated process that controls how quickly and how many times…

Q: How does the Bucket Orchid use secondary metabolites to “manipulate” the bee’s activities? Carefully…

A: There are a few important points:Pollination: Pollination is defined as the transfer of pollen…

Q: Question 1 (1 point) Which statement(s) about the lac operon in E. coli is correct? O A) It is an…

A: The lac operon in Escherichia coli (E. coli) is a well-known example of gene regulation in bacteria.…

Q: 3. In the following diagram, determine the type of transport protein in A. Justify your answer with…

A: Active transport is a kind of membrane transport in which the molecules moves from the lower to…

Q: Which of the following were newly discovered at the depths of the Monterey Bay sea floor? A.…

A: The statement poses a question about newly discovered species at the depths of the Monterey Bay sea…

Q: Stemonitis slime mold

A: Slime molds are a group of fungi-like organisms that have cellulose in their cell wall but do not…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenetic tree and the molecular cladogram are both important tools in molecular biology and…

Q: Which subfield of ecology primarily studies the interactions between multiple species within a given…

A: Ecology is a vast field of science that examines how organisms interact with their surroundings.…

Q: 4. What is ATP? 5. Diagram the ATP Cycle and label all of the parts. 6. What is an enzyme? 7. Define…

A: ATP, or adenosine triphosphate, is a crucial molecule found in all living cells. It serves as the…

Q: It’s late summer and a new influenza virus strain has appeared in chickens across the country. It’s…

A: I would analyze the genetic sequence of the new strain and compare it to the key mutations…

Q: Which type of agriculture describes the process of clearing a small plot of land by burning down the…

A: Agriculture refers to the science and art of cultivating the land of soil, growing large areas of…

Q: A cloned Bam HI DNA fragment, 3.0 kb long, was isolated in preparation for sequence determination.…

A: Restriction mapping is done by analysing and arranging the fragments that are generated by the use…

Q: Does Darwin's theory of natural selection provide evidence for radical contingency? Explain and be…

A: Darwin's theory of natural selection is a cornerstone of evolutionary biology that provides insight…

Q: which of the following are the roles of proteins. select all that apply. - nutrient transport…

A: Proteins are large, complex molecules made up of amino acids. They are essential macromolecules…

Q: Unlike soluble, cytosolic proteins, transmembrane proteins are more difficult to purify, Which of…

A: Over the past few years, research on membrane proteins have made substantial progress. This is…

Q: 5. A DNA sequence of "ACG" will code for the amino acid First mRNA base (5' end of codon) U G UUU…

A: A codon is a sequence of three nucleotides in a messenger RNA (mRNA) molecule that specifies the…

Q: In a three point cross problem for genes Q, L, and T, you have identified the parentals and double…

A: Q.Ans:-Explanation:- Parental:- Parental types are those types of genotype where the offspring…

Q: Which of the following ion transport functions must be carried out by a pump? a. transport of Na+…

A: The flow or movement of ions across membranes is dependent on establishment of ion gradient. Every…

Q: Task 4 of 6 (AC 2.1) No more than 200 words for the task A. Label the conductive tissues in the…

A: A fist-sized organ, the heart circulates blood around your body. It serves as the circulatory…

Q: Which of the following are important pollinators that assist in the reproduction of flowering…

A: Pollination refers to the process through which pollen grains from the male reproductive part of a…

Q: True or False: Fitness is a product of natural selection and has no effect on the evolution of a…

A: Evolution is the process of change in all forms of life over generations. It is the cumulative…

Q: What impact does compounding have in pharmacy? Describe how compounding can improve medication…

A: Pharmaceutical compounding has been practised for a long time, but as more people become aware of…

Q: What are different methods used to render cells competent?

A: Cell is the basic biological unit of life. Each organisms are made up of cell.Competent cells are…

Q: A garden measures 3.0 m by 4.0 m contains 215 roses. Find the population density of the roses. Show…

A: Population density is the number of individuals of a given population in a unit area. Usually,…

Q: identify the label on respiratory system Epithelium and Lamina propria – label the tissue/cells…

A: The complex arrangement of organs and tissues that aids in breathing is known as the respiratory…

Q: Compare and contrast semelparity and iteroparity. How does this differ from determinant and…

A: One of the fundamental biological processes that take place in living things is reproduction. In…

Q: Specificity Constant Turnover number Michaelis Constant Maximum Velocity 2. [] 3. s1 4. [11.51 5. S…

A: The specificity constant, denoted by kcat/Km, is a measure of how efficiently an enzyme converts…

Q: If each adult female powerful owl produces 1 female juvenile (F) each year, the adult survival rate…

A: The population size of a species can be influenced by factors such as reproductive rate and survival…

Q: How do emotions impact the physiological and neurological processes in the human body?

A: Emotions are integral to human experiences, influencing our thoughts, behaviors, and physiological…

Q: a) What is the highest level of protein structure exhibited by the ACh receptor? b) An experiment…

A: Neurotransmitters are endogenous chemical molecules that are produced by neurons of the brain to…

Q: Cell type B (transport protein mutant) Time IN [Na+] 150mM 0 10 ms 20 ms 40mM 40mM OUT [Na+] 15mM…

A: Cell membrane is an amphipathic membrane which means it has hydrophilic side facing the…

Q: 26. Transposons moving by "DNA only" mechanisms use _______, while transposons moving using an…

A: Transposons are DNA sequences that have the ability to move within a genome. They can utilize…

Q: Which of the following are examples of how plants can either benefit or fool herbivores or…

A: 1- A flower produces nectar to attract bees.The flowers which are pollinated by insects are bright…

Q: Describe the 4 essential macromolecules that are important to all living things. Which two…

A: There are four main kinds of organic macromolecules that are present in all living things on Earth,…

Q: Which is NOT true of commercial dairy farming in developed countries. Most commercial dairies…

A: Commercial dairy farming in developed countries is a complex and highly efficient industry that…

Q: 8. Using Data Set B, start by creating 2 scatterplots in Excel to observe pepsin activity at…

A: The enzyme pepsin is essential for the stomach's ability to break down proteins. Chief cells,…

Q: How do emotions influence physiological processes and behavior in organisms?

A: The biological process of emotions is important in the overall functioning and adaptation of the…

Q: How would you prepare a 10-7dilution from a culture? Each of your dilution tubes cannot hold more…

A: Dilution is the process of lowering a solute's concentration in a solution, typically by mixing it…

Q: Vaccination against influenza is considered the most effective way to limit the spread of influenza…

A: Pandemic occurring over time significantly establish long term effects on wholesome population.…

Q: How do the researchers propose to use cancer sniffing worms in real life

A: Any of the several illnesses characterised by the well define specific term that is the growth of…

Q: 2. In a eukaryotic, photosynthetic cell, the photopigment chlorophyll a is located in the…

A: Cyanobacteria, also called "blue-green algae," are the photosynthetic bacteria. The phylum of…

Q: What woman discovered radium and polonium?

A: What is Life's Chemistry? "All living things depend on nucleic acids, proteins, lipids, and…

Q: Which of the following statements are correct? A. Signalling molecules that are lipid-soluble bind…

A: Cellular signalling is a complicated communication mechanism that allows cells to respond to and…

Concept explainers

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase.

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons:

Question

7. Which of the following occurs during prophase I of meiosis?
A. The alignment of chromosomes to the metaphase plate
Inter-chromosomal recombination
B.
C. The formation of chiasmata
D. The separation of sister chromatids
E. The separation of homologous chromosomes

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: About cell division

VIEW

Step 2: Concept of meiosis

VIEW

Step 3: Explanation of Prophase I of meiosis I

VIEW

Step 4: Explanation of incorrect options

VIEW

Solution

VIEW

Step by step

Solved in 5 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Chiasmata: a. form during metaphase II of meiosis. b. occur between two nonhomologous chromosomes. c. represent chromosomes independently assorting. d. are sites of DNA exchange between homologous chromatids. e. ensure the resulting cells are identical to the parent cell.
The part of meiosis that is similar to mitosis is_______. a. meiosis I b. anaphase I c. meiosis II d. interkinesis
A. 1. Division of the cell nucleus, results in two daughter nuclei, each have the same number of chromosomes as the parent nucleus. 2. One two identical halves of a duplicated chromosome. 3. Fusion of haploid (n) gametes; results in the formation of a diploid (2)n zygote. 4. The breaking and rejoining of homologous (non sister) chromatids during early meiotic prophase I, resulting in an exchange of genetic material. 5. The diploid (2n) cell that results from the union of haploid (n) gametes in sexual reproduction. 6. The condition of having one set of chromosomes per nucleus. 7. The complex of DNA, proteins and some RNA that makes up eukaryotic chromosomes. 8. Structures in the cell nucleus, composed of chromatin and containing the genes. 9. An X-shaped site in a tetrad marking the location where homologous chromatids previously underwent crossing over. 10. A sex cell; in plants and animals, an egg or sperm. 11. Type of reproduction in which two gametes (usually, but not necessarily,…
1.What happens during anaphase in mitosis, meiosis I, and meiosis II? What happens if the steps you just described do not occur correctly during meiosis? State the term for this sort of meiotic error and the term that describes the resulting daughter cells.
1. Given: Adult diploid cell (2n = 8) 2. Illustrate the condition of the chromosomes during the following events in Meiosis: a. prophase I b. anaphase I c. telophase I d. prophase II e. metaphase II f. anaphase II g. daughter cells at end of telophase II/cytokinesis
1. Draw a cell in anaphase I of meiosis with: a. 3 pairs of homologous chromosomes: #1a and #1b, #2a and #2b, #3a and #3b. b. Chromosomes #1a and #1b and #3a and #3b are metacentric. Chromosomes #2a and #2b are acrocentric.
.ttomalogous chromoso, C. Area on a chromosome where a gene is found: genes d. Shows two different sister Chromatids b. etaphase I. What are all of the possible gametes that can be -b
1. Given: Adult diploid cell (2n = 8) 2. Show (Illustrate) the condition of the chromosomes during the following events in Meiosis: a. prophase I b. anaphase I c. telophase I d. prophase II e. metaphase II f. anaphase II g. daughter cells at end of telophase II/cytokinesis
1. Define homologous chromosome. 2. Define sister chromatids. 3. Identify whether each process below occurs during mitosis, meiosis, or both. a. Sister chromatids separate b. Haploid cells are formed c. Cell division occurs once d. Homologous chromosomes pair e. 4 haploid cells are the final result f. Crossing over occurs g. Replicated chromosomes line up in the middle of the cell h. 2 diploid cells are the final result
18. Which of the following occurs in meiosis but not in mitosis? A. Attachment of spindle fibers to kinetochore B. Separation of sister chromatids at anaphase C. Replication of DNA prior to start of cell division D. Pairing of homologous chromosomes at metaphase plate
The stage of meiosis in which chromosomes pair and cross over is:a. prophase Ib. metaphase Ic. prophase IId. metaphase IIe. anaphase II
1)Discusses why Meiosis I is referred to as reduction division and why Meiosis II is essentially like Mitosis. 2)Discusses where problems are likely to occur in Meiosis and what these problems could lead to.