7. Once the DNA has been extracted from the nucleus of the cell, t is exposed to that act like a biochemical scissors to cleave or cut the DNA. end to the end. 8. During gel electrophoresis, DNA moves from the bond holds the two strands of DNA together. 9. all tn davellon into a total organism.
Q: Is COVID-19 virus will destroy/damage ALL the blood vessels and layers of the walls of the heart? if...
A: Even though COVID-19, the coronavirus that triggered the global pandemic, is largely a breathing or ...
Q: 13. Give 2 reasons why is meiosis a source of genetic variability for organisms? 1. 2. 14. How many ...
A: INTRODUCTION In genetically , the cell reproduction occur the identical copies of cell growth and...
Q: Describe one of the types of heterotrophs and what they eat
A: There are five types of heterotrophs are found on the Earth as given blow: 1.Carnivores eat the mea...
Q: On which sex is the mandible tip (or the chin) squarer? a. males b. females c. on both sexes d. ...
A: According to many studies researchers have found that Mandible tip (or the chin) squarer is the resu...
Q: the applications of stem cell therapies for the treatment of diseases.
A: This procedure also includes a target cell to which the data can be delivered. This information tran...
Q: 1. Which type of evidence for evolution is most accurate in determining evolutionary relationships-m...
A: There are many arguments in the past about which type of evidence is most accurate in determining ev...
Q: А. $ COOH oligosaccharides transmembrane a helix lipid bilayer В. SH- С. - NH2 SH Figure 10-22. Mole...
A: As the N terminus devoid of glycosylation, so it must be present in cytoplasmic face.. So ans is ...
Q: Explain why we say that photosynthesis feeds most life on Earth.
A: Plants absorb CO2 and water (H2O) from the air and soil during photosynthesis. Water is oxidized (lo...
Q: A phlebotomist, named Toru, is sent to the Emergency Room to collect an EDTA specimen for a stat typ...
A: Introduction: Phlebotomy is the process of inserting a cannula into a vein to extract blood. Venipun...
Q: Explain what occurs during glycolysis, the Krebs (citric acid) cycle, and electron transport chain b...
A: GLYCOLYSIS : * It is an catabolic metabolic pathway which breakdown glucose into 2 molecules of pyr...
Q: Amy is a new mother. Although she is very much against using disposable diapers, she is frustrated b...
A: Advantages and of diapers For babies and toddlers this means they: Are comfortable to wear due to t...
Q: Describe how the environmental temperature can be measured based on displacement change. Support you...
A: There are few important points: Any undesirable change in the physical ,chemical and biological cha...
Q: TEST I. Fill in the necessary concepts about microscopes. OF COMPounb dissection or stereoscope SCAn...
A: Dissection microscope is also known as simple microscope. It has only one lens. Compound microscope ...
Q: Living Things Mammals Fish aroups? Give birth Lay eggs Can fly Cannot fly Give birth Lay eggs panda ...
A: INTRODUCTION Living things are organisms to constitute there life. Living things are mainly s...
Q: Describe the composition of genetic material and Describe the DNA REPLICATION.
A: The hereditary ingredient in a cell is known as genetic material. It contains all of an organism's u...
Q: 6. Contrast the inheritance of linked genes with unlinked genes. What characteristics do unlinked ge...
A: "Inheritance" is the process through which a child gets genetic information from his or her parents....
Q: b. The net protein product is significantly toxic c. The number of faulty transcript is limit...
A: .c. Condensins During M phase of cell cycle condensin proteins maintained chromosome in condensed st...
Q: How did the accidental invention of cheese help Ghengis Khan? (And who is Ghengis Khan?)
A: Genghis Khan's real name was Temüjin.
Q: First degree burns requires a. excising the tissue b. waxing c. excising the tissue, wax re...
A: A burn happens whenever skin tissue is damaged by heat, toxins, daylight, electricity, or radioactiv...
Q: Typically during the process of in vitro fertilization, several eggs are fertilized. If two of these...
A: According to Chargaff’s rule, the DNA molecule contains an equal amount of pyrimidine (thymine and c...
Q: How and why have humans changed animals over time through artificial selection?
A: Q. How and why have humans changed animals over time through artificial selection? Answer - Artifi...
Q: The arrow is pointing to a cavity called a that is normaily filled with
A: Answer: The arrow is pointing to a cavity a ventricle that is normally filled with fluid. Option b)...
Q: How does the body restore normal blood calcium levels during a state of hypocalcemia (low blood calc...
A: Endocrine and exocrine systems are both present in the human body. Endocrine and exocrine systems ar...
Q: Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT...
A: Introduction:- A protein molecule is much larger than a sugar or salt molecule, and it is made up of...
Q: If a cell grows on a minimal media and it is made up of phosphate as a source of carbon and energy, ...
A:
Q: List at least one reason why arteriole vasoconstriction helps mammals function and survive
A: *The arterioles main function is to regulate the blood flow r intravascular pressure bu undergoing c...
Q: taxonomical heirarchy
A: Taxonomic hierarchy is the process of arranging various organisms into successive levels of the biol...
Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...
A: The brown fur (BB) color is dominant to black fur (bb) color while pigment production (BB, Bb) is do...
Q: Study the graphs shown in the picture. Describe the patterns observed in the top group depicting ch...
A: Biodiversity refers to the variety of life on earth at ecosystem, genetic and species levels.
Q: Patients, who have a defect in one of the DNA repair systems may have what? Check All That Apply A....
A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA rep...
Q: Why did it take so long for scientists to figure out that infections are caused by bacteria? What we...
A: Bacteria is prokaryotic microorganism.
Q: TRUE OR FALSE
A: Puberty is the time when a boy or girl becomes sexually mature. It occurs between ages 10 and 14 for...
Q: You are trying to predict phenotypes for abdominal bristle number in a population of fruit flies usi...
A: The term heritability can be described as the measure used for finding out a particular trait’s degr...
Q: 3 4 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху Match the chromosome to its homologous chromos...
A: 1 answer... The total chromosome is 46 or 23 pair, because the each homologous chromosome have two ...
Q: Why is there an argument among scientists about recognizing Anthropocene as an epoch?
A: Epoch means an event or a very long time marked by an event that begins a new period or development....
Q: In which type of cross(es) can we apply and demonstrate the law of segregation and law of independen...
A: The process through which a child inherits genetic information from a parent is known as inheritance...
Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...
A: The study of what makes a certain action in a specific scenario the proper thing to do is known as e...
Q: Explain why enzymes are considered “biological catalysts” Use the following terms in the explanation...
A: Answer
Q: 2. Give all possible "GAMETE’ combination before it cross using: а.) ААВВСС b.) XXYYZZ c.) DdEeff
A: Introduction: Law of segregation states that the two factors for a trait, present together in a hete...
Q: EcoRI 290 bp 3800 bp EcoRI PUC19 PUC19 3400 bp Bgll EcoRI 290 bp EcoRI 1900 bp PUC19 1500 bp
A: A plasmid circular, small, extra chromosomal double stranded DNA (dsDNA). pUC19 plasmid is one the p...
Q: 2. Brown eyes are dominant over blue eyes in humans. Having a peaked hairline is dominant over havin...
A: Homozygous - This is a genetic state in which a person inherits the same alleles from both parents f...
Q: counter-current flow within fish gills, A. oxygen-poor water is in contact with oxygen-rich blood; B...
A: The countercurrent mechanism is a way that will ensure maximum absorption of oxygen by the gills ...
Q: 2. During the course of the growth of the soybean, you measured the volumetrie water content of the ...
A: The total volume of water applied during an irrigation event in megalitres (ML) is: the inflow rate ...
Q: Why is cholesterol important in the human body?
A: Sterols are substances that lack fatty acids yet possess fat-like characteristics. Each sterol is ma...
Q: Elephant Seals have a polygynous mating system, in which a few males mate with many females while ot...
A: Elephant seals are carnivorous mammals that are found in the Americas. These seals live in colonies....
Q: For a simulated population in AlleleA1 to be in Hardy-Weinberg equilibrium, the mutation rate would ...
A: The physical traits or appearance of an organism are referred to as its phenotype. The genotypes, or...
Q: 7. In simple terms, describe how crossing over is carried out. How does it generate variability?
A: The interchange of genetic material in the germ line is referred to as crossing over.During meiosi...
Q: Which of the following statements accurately describes water vapor? The liquid phase of water is ...
A: Climate change is shifts in weather patterns and temperature.
Q: Perform the Fork-lined method of the given alleles. A male having a characteristic of TtSsYy and a ...
A: Genetics is the study of the functioning and main codes of variation and heredity. Inheritance is th...
Q: 5. Molecule #5 a)What Group? (Carb, Lipid, Protein, or Nucleic Acid). b)Within the group, how would ...
A: Macromolecules are a large molecule that includes biomolecules such as protein, lipid, nucleic acids...
Please help item 7 to 9
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand8. Shown below is a DNA strand. 5' GACGTACTACGACTATGGC 3' What is the correct representation of its complementary strand?1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
- 1. Draw an accurate segment of DNA with its complimentary strand. (10 points) Make sure to include the hydrogen bonds between base pairs of different DNA strands. 5'-CT-3' art to quo lexorbyd- ods tson ont to guzaris robitoslaun vnem to memylog 18 ablos om buit quors serigaorig art of abnod abitosloun enoWhich of the following double stranded DNA molecules would require the most amount of energy to denature into single strands? GAGGTCTGG AGGGCGTAA GTATGGACT IV. TTTGGCTAT GAATTCATA Ov.The diagram shows the structure of DNA with complementary base pairing between strands. Bood 3' CG AT ౦ార G C CG CG 3' 5 What is the benefit of this complementary nature of DNA? O It helps in controlling the amount of protein produced by the cells. O It helps in storing all the information required for the cell to function efficiently. It helps in the synthesizing of two new identical DNA strands from each parent strand O It helps in the unwinding of DNA allowing for the formation of chromosomes during mitosis
- 1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'5. The following diagram uses colors to illustrate the replication of a chromosome. Use your knowledge of DNA replication to determine whether or not the illustration is accurate. If it is not accurate, briefly ex- plain how to make it correct. DNA molecule prlor to replikation DNA moleaule is replkated DNA molecule DNA molecule after replcation after replkation8. Discontinuous DNA replication generates short fragments of DNA called Okazaki fragments.Which enzyme is responsible for joining the Okazaki fragments? Endonuclease O Polymerase Primase O Ligase 9. Vacuoles are fluid-filled organelles present in some cells.Which function is NOT normally performed by vacuoles? Store enzymes that degrade biological molecules Store pigments responsible for the different colors in plants Store salts, sugars, and waste products O Store DNA and other hereditary materials 10. Glycolysis is a series of enzyme-catalyzed reactions that converts glucose molecules into pyruvate and yields a net of two molecules of adenosine triphosphate.Which molecule donates two phosphate groups to glucose to form fructose-1,6-bisphosphate in the early stage of glycolysis? Adenosine diphosphate (ADP) Adenosine triphosphate (ATP) Glyceraldehyde-3-phosphate (G3P) O Guanosine diphosphate (GDP)
- 14. What term describes this change + LYNAS age to DRZAT 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG3. DNA is a double helix. The sequences of based on one side of the DNA molecule are complementary to the other side of the DNA molecule. If one side of the DNA strand was ATA GTA CTC TGA, what would the other side be?Asap