57. A 65-year-old man is brought to the physician by his wife. She says, "His appearance has been so strange lately. He has been neglecting his grooming, and I have to put his left arm into the sleeve of his shirt." The left side of his face is unshaven. When asked to fill in the numbers on a clock face, he writes the numbers as shown in the diagram. The most likely explanation for these findings is a lesion in which of the following nondominant areas of the brain? A) Frontal lobe B) Occipital lobe C) Optic nerve D) Parietal lobe E) Temporal lobe

Q: A- Describe the anatomy and physiology of a dog's dewclaw.

A: A dewclaw is a vestigial finger found on the feet of many species. It frequently develops higher on…

Q: Describe the function of four inclusion.

A: The basic structures, called inclusion bodies, are nuclear or cytoplasmic aggregates of proteins and…

Q: Herceptin is an antibody that binds to a class of oestrogen receptors and is used to treat some…

A: Introduction: The unregulated proliferation of cells in the breast area is known as breast cancer.…

Q: Tamayo in one of her experiments seemed to have a cure for Nezuko's demonification. She found out…

A: In the analysis of the reaction kinetics concerning Nezuko Kamado's blood concentration (K), the…

Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…

A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: A 30 - year - old woman was undergoing therapy for b-thalassemia,a recessive trait caused by absence…

A: Bone marrow or HSC (hematopoietic stem cells) transplantation is a procedure during which healthy…

Q: What is complementation group ?

A: A category of mutant genes that do not complement one another

Q: Which two items can be used to check the alignment of the annulus and phase ring?

A: A microscope is an instrument used to view small objects that cannot be seen with an unaided eye.…

Q: Sis is a chronic respiratory condition caused by Mycobacterium tuberculosis, a highly contagious…

A: Immune system is an important aspect in the human body it mainly helps the body defend itself…

Q: Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and…

A: Chromosome is a thread like structure containing a part or all of the genetic material of an…

Q: ckle-cell anemia is an interesting genetic disease. Normal homozygous individials (SS) have normal…

A:

Q: Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a person…

A: Sickle Cell Anemia It is a blood disorder where RBCs take up crescent or sickle shaped. These…

Q: Correct and rewrite the statement by changing the biological term that is underlined for each…

A: Solution: In the instance of the French biologist Jean-Baptiste Lamarck, his name has been…

Q: What is the molecular defect associated with sickle-cell anemia?

A: Sickle-cell anemia is the disease associated with the defect in the normal hemoglobin molecule…

Q: Ultraviolet light causes thymine dimers to form in DNA. Some individuals are genetically incapable…

A: Genetic variation is very important for evolution, but genetic stability is crucial for survival…

Q: The Bence-Jones protein is a protein with a molecular weight of approximately 150 kDa and is found…

A: Bence Jones Proteins was used in 1880 by Dr. Fleischer which is a monoclonal globulin protein found…

Q: Why is the Philadelphia chromosome important to understanding & treating some cancers, especially…

A: Philadelphia chromosome is only present in the blood cells that are affected because of the damaged…

Q: 19) Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry oxygen.…

A: Given: Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry…

Q: Albinism (achromia) is a genetic condition in which an individual cannot synthesize melanin from…

A: Albinism is a genetic disorder in which affected peoples show no or little color to the skin, eyes,…

Q: Given that this mutated allele will cause disease and death in individuals, what would you predict…

A: Sickel cell anemia is an autosomal recessive genetic disorder that affects the shape of red blood…

Q: Fetal hemoglobin comprises of αγ sub-units. It has been found that the γ-chain contains serine at…

A: Introduction:- Fetal hemoglobin (HbF) is a prominent type of hemoglobin that is present in the fetus…

Q: In "Your Genes, Your Choices," Priya is concerned about Huntington's disease, an autosomal dominant…

A: This is a disease that is autosomal dominant. It is an inherited neurodegenerative disease that…

Q: What will be the effect of mutation that turns lysine to arginine

A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…

Q: When James was diagnosed with lung cancer, the oncologist explained to him how the disease can…

A: Cancer is a condition that is characterized by abnormal growth of cells. Cancer may be either…

Q: How does the puzzle  look when completed?

A: Any change in the nucleotide sequence of DNA is called mutation. Mutations may be introduced…

Q: One example of a DNA virus (a virus that uses DNA, not RNA, as its genetic material) that causes…

A: Viral families are grouped on the basis of type of genetic material DNA or RNA.A DNA is a virus that…

Q: Insulin dependent diabetes is caused by the degeneration of beta cells due to a _________.a) gene b)…

A: Insulin-dependent diabetes is otherwise known as Type 1 diabetes (T1D). This medical condition is…

Q: (b) Correct and rewrite the statement by changing the biological term that is underlined for each…

A: The correct statements are as follows -

Q: The association of specific kinds of stomach cancer with blood type "O" is informative because   a)…

A: Blood is a liquid substance which flows in the blood vessels and carry nutrients and oxygen to the…

Q: What is read count?

A: Deoxyribonucleic acid (DNA) is the genetic material. It is a polymer of nucleotides. DNA sequencing…

Q: How many DNA strands are present in the nucleus of a liver cell in humans?

A: Introduction  DNA stands for Deoxyribonucleic Acid. It is a carries genetic information. DNA is…

Q: People suffering from chronic stress appear to have more health problems and to age prematurely. Is…

A: Stress is often associated with aging and health issues . The scientific explanation of this…

Q: Sickle-cell disease is caused by a mutation.

A: The general shape of the RBC is round. Actual changes in the structure of gene and its amino acid…

Q: Baby Jordan was born in the middle of the COVID-19 crisis in Chicago, Illinois. His parents Dane and…

A: 1. Tyrosine and melanin  are the two amino acids  that are involved An enzyme ( tyrosinase )helps…

Q: A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase…

A: Mutation refers to sudden change in the genetic material and is heritable. It may be on chromosomal…

Wound infections

A wound is damaged or breaks in the surface of the skin. The wound is divided into two types, they are acute wound that includes minor cuts, laceration, bites, etc, and chronic wounds that can become slow to heal including ulcers on the legs and feet. Redness, pain, and swelling are signs of a wound.