5. WEEK 2 PROBLEM Please transcribe AND translate the DNA sequence. You do need to find the complimentary base pair before transcribing. DNA: mRN Amino a CGCTACAAGTCACGTACCGTAACGACT
Coding Strand of DNA
When pointing to DNA transcription, the coding strand is found to be the DNA strand whose base sequence is indistinguishable from the base sequence of the RNA transcript developed. It is this strand that comprises the codons, while the non-coding strand comprises the anti-codons.
Nucleotide
Both DNA and RNA are composed of organic molecules known as nucleotides. Hence, nucleotides are known as the basic building blocks of nucleic acids. These substances play a role in various processes such as cell signalling, enzyme reactions, metabolism, and so on.
Structure of Cytosine
Cytosine is among the five primary nitrogenous bases of which DNA and RNA and are being used in storage and transportation of genetic makeup within a cell. Adenine, guanine, thymine as well as uracil are the remaining four nucleobases.


•Here DNA sequence is given and we have to make RNA and Amino acid sequence from that.
TRANSCRIPTION:-This is the process of formation of RNA from DNA.
DNA--> RNA
•RNA sequence is complementary to DNA sequence and URACIL(U) present instead of THYMINE(T).
TRANSLATION:- This is the process of formation amino acid sequence from RNA.
RNA--> Amino acid
•For formation of Amino acid we use triple codon method in which three base present and they code for a specific amino acid.
Step by step
Solved in 3 steps









