40 3606.82 3116.87 1850.26 1781.16 1445.69 1350.12 1284.09 1240.72 1143.49 1058.83 990.82 946.39 924.00 891.43 867.15 843.36 696.90 560.66 Wavenumbers (cm-1) 00s7 009 000L 00S1 0007 0008 00SE 000 -40 -30 -20 -10 10- 20 os 09 08 06 110 120FHydrolyzed Dicarboxylic Acid Final Product 5/19/2020

Q: Molecules that are nonsuperimposable mirror images of one another are called

A: They are optically active isomers .These molecules have same molecular mass but rotate the plane…

Q: Which infornation does the pre-exponentail factor contain?

A:

Q: Choices: L-оли НО OH XxX V-сяч nka 1 UL-сяч nka-11 nka

A: Here we have to match the correct order of pKa of the given compounds. Acidic strength is inversely…

Q: What is the hydrogen deficiency index and calculate it for chrysin?

A:

Q: Positive centromere staining is typically associated with which disease process?   Question 8…

A: The question is asking which disease process is typically associated with positive centromere…

Q: Given the figure below, Which of the following statements is true? a. Blue dye is more polar than…

A: The correct answer about TLC is given below

Q: How many C13 signals are in the compound C17H36?

A: The compound is an alkane having formula CnH2n+2 Here n= 17

Q: what is the proper name for this module?

A: The given model of the compound is a “skeletal-formula” model which is also known as “line-angle…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: 1. Please describee (1) Type I B-Turn and (2) Type II B-Turn in detail. 2. Please show a protein…

A: Understanding the three-dimensional structure of proteins is fundamental to unraveling their…

Q: a 3d structure of protein with acces number of P02008 at uniprot database.

A: The objective of the question is to find the 3D structure of a protein with the access number P02008…

Q: The UV-vis absorption spectrum of the peptide RYYFE collected in a 1 cm pathlength cuvette exhibits…

A: the optical path length and the molar concentration of the solution. i.e.…

Q: Parallel and anti-parallel beta sheets are found in proteins, but more often the latter. This is…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Draw indinavir analogues HN. 3 OH C OH N. O Z: N -Z NH

A: Indinavir is an antiretroviral drug that belongs to a class of medications known as protease…

Q: X: reproduce the interatomic interactions Y: define a computable energy (such as Gibb's free energy)…

A: The complete structure of a protein can be divided into 4 based on the complexity: primary,…

Q: If a solution has a pH of 5.5, and Cysteine has a pl of 5.07, anwser the following questions: a. Is…

A: The amino acid has an amine group and a carboxylic acid group. So, it will exist as a zwitterion in…

Q: nucleoside phosphate?

A: Nucleoside is a compound having a nitrogenous base and a phosphate group. It consist of a molecule…

Q: how many drugs could we test for antitumor activity with a 51x41 grid ofcompounds?

A:

Q: Match the letter with the correct answer: A Cheose.. Choose.. Origin line Low palar sample

A:

Q: protein. 57. This is a chemical structure of Oprimary O ertary quarternary 58. This picture of…

A:

Q: Incubation with primary antibody should be accompanied with agitation, why?

A:

Q: Explain about N-formylmethionine (fMet) ?

A: N-formylmethionine, also known as fMet is a derivative of methionine amino acid. In this a formyl…

Q: What are the challenges associated with developing effective drugs for targeting membrane proteins?

A: Developing effective drugs for targeting membrane proteins poses several challenges in medicinal…

Q: What are the challenges and potential strategies for developing effective therapeutics targeting…

A: Targeting protein-protein interactions (PPIs) in medicinal chemistry presents significant challenges…

Q: How can the rational design of small molecule inhibitors be optimized to improve their potency and…

A: The rational design of small molecule inhibitors plays a crucial role in medicinal chemistry, aiming…

Q: IV. Match the following: Numbers Do not use criss cross lines but use number to match 1. Vasopressin…

A: Hormones are nothing but the chemical messengers that are secreted directly into the blood. There…

Q: Gabapentin synthesis and which name reaction ?

A: On the reaction between diethyl malonate and cyclohexanone, a tetrahedral carbonyl addition compound…

Q: justify the ingridients of benadryl cream

A: The Benadryl cream is actually an itch stopping cream. It is used to relieve itching and pain…

Q: Draw the protein given by the sequence TIP and circle any chiral carbons.

A: The question is based on the concept of amino acids. we need to identify amino acids present in…

Q: Anti-RNA antibodies are often present in individuals having an antinuclear antibody…

A: The objective of the question is to identify the antinuclear antibody (ANA) immunofluorescent…

Q: 1

A: The system of a heterocyclic pyrimidine is a six membered system which consist of the 4 carbons and…

Q: spelled name of RbCN

A: While naming cation is named first and then the anion.

Q: What type of antibodies are indicated by a positive peripheral or rim pattern observed on an ANA…

A: The objective of the question is to identify the type of antibodies that are indicated by a positive…

Q: How does SERS work?

A: SERS stands for surface-enhanced Raman scattering.

Q: Why nucleoside dissolve in water

A: Interpretation: The reason behind the nucleoside dissolve in water is to be explained.

Q: Question attached

A: Paper chromatography is a qualitative method in order to detect the presence of colored components.…

Q: What do you mean  by pyrimidines ?

A: Both purines and pyrimidines are most important parts in the nucleic acids. The genetic information…

Q: c. Explain the difference of pKa of the following two compounds Н Н ver ets hanyal pka HTC H 43 than…

A: Answer:More stable the conjugate base of an acid is, more reactive the acid will be and vice versa.…