4.17 LAB: Input and formatted output: Caffeine levels A half-life is the amount of time it takes for a substance or entity to fall to half its original value. Caffeine has a half-life of about 6 hours in humans. Given caffeine amount (in mg) as input, output the caffeine level after 6, 12, and 24 hours. Use a string formatting expression with conversion specifiers to output the caffeine amount as floating-point numbers. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print('{:.2f}'.format(your_value)) Ex: If the input is:

WAP in Python for Disarium Number?

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…

Where should I put my Python files when I upload them to Blackboard to hand in to my professor?