4. A plane leaves Miami, FL, on a heading of N 50° W towards Denver, CO. In Denver, the plane offloads half its passengers, and redirects towards Chicago. The bearing for this flight is N 80° E. From here, the plane returns to its hangar in Miami. If the straight line distance from Miami to Denver is 1725 miles, and the bearing from Chicago to Miami is S 30° E, what is the total distance covered by the plane during its round trip? ING OLORADO TEXICO Paso Denver AHUA SOUTH DAKOTA NEBRASKA COAHUILA KANSAS TEXAS OKLAHOMA Minneapolis Austin Kansas City Dalles San Antonio IOWA WISCONSIN 1725 MISSOURI ILLINGA Houston ARKANSAS masi LOUISIANA New

Q: What does lithology for carbon storage reservoir mean? What is Karst Limestone, Columnar basalt ,…

A: Lithology for carbon storage reservoir means the physical properties or characteristics of rocks…

Q: Explain why Rome has a rainy and dry season?

A: Answer) Rome has both dry and rainy season and it poses a Mediterranean type of climate…

Q: Make a claim whether or not you think that the climate is changing. Please support your claim with 3…

A: Change climate alludes to long haul shifts in temperatures and weather conditions. These movements…

Q: letter "A" can best be identified as:

A: A river is a naturally flowing body of freshwater that flows towards the lake, ocean, sea, or…

Q: If 14,902 atoms of helium pass through a 3 square meter plate area every 3.20 hours, and if this…

A:

Q: If you become an ecologist, what scale of ecology would you study?      Why? Give an example of what…

A: As an ecologist, community ecology must be studied.

Q: 1. Consider the longitudinal profile of a stream system that empties into the ocean (sea level= base…

A: The base level of a stream is defined as the lowest level in which running water can flow. At the…

Q: What is the horse's forelimb Class 1 lever MA? Type your numeric answer and submit

A: Horse forelimb lever MA=EFL/RFL =12/90 =0.133.

Q: Accretion took longer further from the Sun, so the more distant planets formed their cores later and…

A: Jovian planets: Jovian planets are a group of four planets in our solar system and are also known as…

Q: Which of these land plants have a dominant sporophyte phase? Please select all correct answers.

A: Sporophyte is the nonsexual diploid phase in plants and some algae.  a. Conifers are gymnosperms and…

Q: Suppose a galaxy is 48 Mpc away from us. How many years ago did the light we're receiving today…

A: Given the galaxy is 48Mpc away from us.  We know the speed of light is 3.0 x 105 km/sec.  From which…

Q: marks Profiles Tab Window Help Untitle aurus.com SOC 10 03/quizzes/351189/take/questions/7958301 le…

A: The stalactite and the stalagmite are the geomorphological features in a limestone terrain.  When…

Q: What is a trace fossil? Multiple Choice O a feature that looks like a fossil but was created through…

A: Tracks and trails (footprints), burrows and bores (worm holes), gastroliths (stomach stones), and…

Q: A cylindrical bucket has a diameter of 9" and a height of 10". The mass of the bucket is 350 g. The…

A:

Q: MULTIPLE CHOICE Question 6 A student states that rocks that exist at high temperatures and pressures…

A:

Q: 4. The picture below shows a river in Washington discharging to the ocean in a hyperpycnal state,…

A: Debris flows can be caused by snowmelt, dam breaks, glacial outburst floods, or landslides that may…

Q: What is the most important reason why an icy moon is more likely to be geologically act A) Ice is…

A: Answer) Liquid Water has higher heat capacity than the land (Rock), but solid ice has lower heat…

Q: #2 TACCCCTCTAATGACAGTACT TRANSCRIPTION mRNA: Protein (amino acid sequence): TRANSLATION

A: The RNA TO mRNA follow this sequence A to U. C to G. T to A.

Q: cuss the difference between a continental climates versus marine climates and include WHY there is a…

A: S. No. Continental climate Marine climate 01 Continental climate is influenced by nearby land.…

Q: explain Water deep in the earth

A: It is believed that deep beneath the Earth we have more water than the water present in the ocean…

Q: depth, m 0 50 100 150 200 horizontal velocity, m/y 10 bedrock 20 30 The figure at left shows the…

A: Strain rate * Parallel length = Position rate is the formula for calculating the straining rate.

Q: Write a paragraph describing the environmental issue. Use environment science terms and ideas. to…

A: Carbon Emissions:  According to the climatologists, carbon dioxide is a colourless non poisonous…

Q: Elevation in Feet Al S 1:24,000 1000 900 9. Construct a topographic profile from A to A' on the…

A: Map 1: Topographic profile from A to A' on the graph paper

Q: Why were Galileo's observations so upsetting to ancient beliefs about the Universe? Select the best…

A: need to write down the correct answer.

Q: The leading explanation for the global warming "pause" in the mid 2000s is: (A) reductions in CO2…

A: The global warming pause means the global warming has slowed down in the past 15 years. It became…

Q: In relation to renewable energies and sustainability, what are the advantages and disadvantages?

A: Renewable energy sources are perfect to use as there are less ozone harming substance discharges.…

Q: Determine the following for a humid air stream at 1 atm if the enthalpy deviation is - 0.6 kJ/kg dry…

A: d) Since we are aware of the dew point temperature, which is 29°C, we will draw a straight vertical…

Q: How has Covid affected plastic waste? What are some global environmental problems caused from covid…

A: Plastic garbage harms aquatic environment and has grown to be a significant environmental problem.…

Q: Using Dataloggers in Field Studies Usually, when we collect information about populations in the…

A: 1. The act of selecting a group of people to represent the total population is known as population…

Q: 15. The map below shows waves approaching a Texas barrier island. As a wave breaks on the beach,…

A: correct option is (C) pathway C during the long-shore drift the waves break at angle to the shore…

Q: Q3 Which of these statements is not true with regard to combustion chemistry and acid rain…

A: *The majority of sulfur oxides are produced when fuels that contain sulfur undergo combustion and by…

Q: 2. Consider a parcel of air which reached saturation at a temperature of 3 °C and a pressure of 500…

A: solution

Q: 3. A volumetric flow rate of 120 m³/min of mixture of real gases composed of (40 mol % hydrogen, 35%…

A:

Q: should be a minimum of a typed page in length - be sure to include a complete analysis of your…

A: Human-caused temperature change is expanding fire movement across lush land inside the western u. s.…

Q: Match each plant species with the correct group of land plants. Drag and drop options on the…

A: The match of the the plant species with the correct group of land plant is given in step 2 according…