3. The program shall: generate a random number from 1 to 50 for a player to guess; • display a message that indicates whether the player's guess is correct, too low, or too high; and • prompt the user to keep on guessing until the correct value is entered 4. Create a try-catch structure that will handle two (2) exceptions. These are when the user inputs the following: a number that is out of range (1- 50) a letter or any non-numeric character 5. Prompt the user so that he can guess again if an exception is thrown. 6. Display the number of total guesses. Note: An invalid input (when an exception is thrown) is not considered a valid guess or attempt. Sample Output: Guess a nunber from I to 501 30 Too high. Try again. 15 Too high Try again. 10 Too high Try again. Too lov. Try again. gverty Invalid input. Guess a nunber from 1 to 501 51 Out of range. Guess a number trom 1 to 501 Too lov. Try again. Too lov. Try again. 19 You got it in 7 attempt (s)!

3. The program shall: generate a random number from 1 to 50 for a player to guess; • display a message that indicates whether the player's guess is correct, too low, or too high; and • prompt the user to keep on guessing until the correct value is entered 4. Create a try-catch structure that will handle two (2) exceptions. These are when the user inputs the following: a number that is out of range (1- 50) a letter or any non-numeric character 5. Prompt the user so that he can guess again if an exception is thrown. 6. Display the number of total guesses. Note: An invalid input (when an exception is thrown) is not considered a valid guess or attempt. Sample Output: Guess a nunber from I to 501 30 Too high. Try again. 15 Too high Try again. 10 Too high Try again. Too lov. Try again. gverty Invalid input. Guess a nunber from 1 to 501 51 Out of range. Guess a number trom 1 to 501 Too lov. Try again. Too lov. Try again. 19 You got it in 7 attempt (s)!

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

python: def shakespeare_position(role, section): """ Question 2 - Regex You are reading a Shakespeare play with your friends (as one frequently does) and are given a role. You want to know what line immediately precedes YOUR first line in a given section so that you are ready to go when it is your turn. Return this line as a string, excluding the character's name. Lines will always begin with the character's name followed by a ':' and end in a "." or a "?" Each line is separated by a single space. THIS MUST BE DONE IN ONE LINE. "" Args: role (str) section (str) Returns: str section_1 = 'Benvolio: By my head, here come the Capulets. Mercutio: By my heel, I care not. ' + 'Tybalt: Gentlemen, good den - a word with one of you. Mercutio: And but one word with one of us?' >>> shakespeare_position('Tybalt', section_1) 'By my heel, I care not.' >>> shakespeare_position('Mercutio', section_1) 'By my head, here…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Python: numpy def serial_numbers(num_players):"""QUESTION 2- You are going to assign each player a serial number in the game.- In order to make the players feel that the game is very popular with a large player base,you don't want the serial numbers to be consecutive. - Instead, the serial numbers of the players must be equally spaced, starting from 1 and going all the way up to 100 (inclusive).- Given the number of players in the system, return a 1D numpy array of the serial numbers for the players.- THIS MUST BE DONE IN ONE LINEArgs:num_players (int)Returns:np.array>> serial_numbers(10)array([1. 12. 23. 34. 45. 56. 67. 78. 89. 100.])>> serial_numbers(12)array([1. 10. 19. 28. 37. 46. 55. 64. 73. 82. 91. 100.])""" # print(serial_numbers(10)) # print(serial_numbers(12))
X609: Magic Date A magic date is one when written in the following format, the month times the date equals the year e.g. 6/10/60. Write code that figures out if a user entered date is a magic date. The dates must be between 1 - 31, inclusive and the months between 1 - 12, inclusive. Let the user know whether they entered a magic date. If the input parameters are not valid, return false. Examples: magicDate(6, 10, 60) -> true magicDate(50, 12, 600) –> false
please code in python regular expression In some web forms, users must enter a phone number, and some of these aggravate users byaccepting only a specific format. You have been hired to write a program that reads U.S. phone numbers with the three-digit area and seven-digit local codes accepted as ten digits, or separated into blocks using hyphens or spaces, and with the area code optionally enclosed in parentheses. For example, all of these are valid: 555-123-1234, (555) 1234567, (555) 123 1234, and 5551234567. Read the phone numbers from user input and for each one echo the number in the form “(999) 999 9999” or report an error for any that are invalid, or that don’t have exactly ten digits.
PARTICIPATION ACTIVITY Arrange the following lines to make a program that determines when the number of people in a restaurant equals or exceeds 10 occupants. The program continually gets the number of people entering or leaving the restaurant. Ex: 2 means two people entered, and -3 means three people left. After each input, the program outputs the number of people in the restaurant. Once the number of people in the restaurant equals or exceeds 10, the program exits. If an Input MismatchException exception occurs, the program should get and discard a single string from input. Ex: The input "2 abc 8" should result in 10 occupants. Not all lines are used in the solution. How to use this tool ✓ Unused totalNumPeople += scnr.nextInt (); while (totalNumPeople < maxNumPeople) { } } 11.1.5: Handling input exceptions: restaurant max occupancy tracker. catch { try { catch (InputMismatchException e) { scnr .nextLine(); scnr.next(); System.out.println("Error"); } System.out.println("Occupancy:…
Help me homework c++ The shots file holds a list of shots (imagine some hitscan weapon in a video game like a shotgun or something). Each shot has an origin and a direction. The origin is an (x,y) coordinate, like (5,3). The direction is a slope and whether the shot is traveling along that slope or in the reverse. A slope of "Vertical" means that the shot is travellingstraight up and down. The format is:x_location y_location slope(either a number like 2.1 or a non-number meaning"Vertical") forwards(1 meaning forwards, 0 meaning backwards) 0 0 0 00 0 0 10 0 Vertical 00 0 Squirrel 110 10 -1 1-10.1 -100.01 2.1 0 The first line is a horizontal line shooting left from the origin (0,0).The second line is a shot also travelling horizontally from the origin, but forward along the x axis instead of backwards.The third line is shooting straight down out of the originThe fourth line is shooting straight up out of the origin (any non-number means Vertical, not just Vertical)The fifth line is…
(16) 6. You want to write a Java application that creates a while loop that runs until the user enters a 0 as input. Each time the while loop runs, it displays a menu of three choices as will be shown in the sample run below. When the program reads in the user's choice, that choice should be read in as a String called choiceStr. Then, choiceStr should be converted into an int called choice by using the code below: int choice Integer.parseInt(choiceStr); If the user enters a 1 for choice == 1, the program will print "Choice 1" to the screen. If the user enters a 2 for choice == 2, the program will print "Choice 2" to the screen. Here is a sample run: 0 - to quit 1 to print Choice 1 2 to print Choice 2 Enter choice: 1 Choice 1 0 - to quit 1 to print Choice 1 2 to print Choice 2 Enter choice: 1 Choice 1 0 to quit 1 to print Choice 1 2 to print Choice 2 Enter choice: 2 Choice 2 0 - to quit 1 to print Choice 1 2 to print Choice 2 Enter choice: 0
Exercise 3 – Roman Numerals Exercise Tasks: Create a visual studio C++ project exercise3 and submit the cpp file when completed Create a C++ program that converts integers between 1 and 3999 into the corresponding roman numerals. Your solution should print an error message for incorrect input. The following roman numeral conversions should prove useful: 1. I 6. VI 50. L 900. CM2. II 9. IX 90. XC 1000. M4. IV 10. X 100. C 5. V 40. XL 500 D. Modify the following tester code to obtain an integer from the user and check that it is between 1 and 3999. Then print out the corresponding roman numerals. While the sample code uses an ifthenelse, you could also use a switch statement. /****************************************************** * Roman Numeral Converter August 13 * converts base 10 positive integer >=0 <4000 to roman numerals * @author <your name here> */ #include <iostream> using…
c++ program need help You are given a file containing many words. Read in all of the words from the file and insert each word into a searchable ADT. Give the user a looping menu allowing them to search for words in the word list. Searches must be be found in O(1) or constant time. Your code must time the search operations, and display the time to the user. For this assignment, you may use the provided word list or another word list with more than 150,000 words. Include this file with your submission. You must design and implement the following classes: Word: This class holds a single word as a string. Basic getters and setters are required. HashTable: This class represents the hash table for storing many words. Main: This is the driver class. The driver: Create a Hash Table Read in all of the words from a text file into the Hash Table Provide a looping menu for the user to perform searches. Time all searches and display the execution time to the user For each search: Prompt…
Part 2 - OddOrEven ClassWrite a program that prompts the user to enter an integer. The program should display “The input is odd" to the screen if the input is odd and displays “The input is even" to the screen if the input is even. Hint: Consider using the mod (%) operator
c# Danielle, Edward, and Francis are three salespeople at Holiday Homes. Write an application named HomeSales that prompts the user for a salesperson initial (D, E, or F) input as a string. Either uppercase or lowercase initials are valid. While the user does not type Z, continue by prompting for the amount of a sale. Issue the error message "Sorry - invalid salesperson" for any invalid initials entered. Keep a running total of the amounts sold by each salesperson. After the user types Z or z for an initial, display each salesperson’s total, a grand total for all sales, and the name of the salesperson with the highest total unless there is a tie. If there is a tie, indicate this in the program's output with the message: "There was a tie". An example of the program is shown below: Enter a salesperson initial >> D Enter amount of sale >> 10 Enter next salesperson intital or Z to quit >> d Enter amount of sale >> 2 Enter next salesperson intital or Z to quit…