PLEASE help me to respond this question, anything you can help please. I really need help (G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams,what mechanical stress would the construct experience?(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure,and it increases in dimension in the perpendicular direction, what do you knowabout the Poisson's ratio of this material? Explain how the behavior compares witha typical material. 3. DNA is a polymer that is a chain composed of multiple monomers. By convention, wewrite the chemical formula of the polymer sequence in shorthand notation, where eachmonomer is represented by a letter.Consider the DNA sequence:ATATGACGATTGATATCCGGGATACT(A) How many distinct types of monomer units are in this polymer?(B) Considering the ordering of the monomers, what is this type of polymer called?(C) We can use a sequencing machine to artificially construct any DNA sequence wewant, such as this:AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAAWhat type of polymer would this be?(D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You findthat when you measure the mechanical properties along one direction of the crystalit has a different response than along the opposite direction.What do you call a material when the measured properties are different along differentcrystal directions?(E) You melt the DNA crystal by raising the temperature and let the crystal reform at ahigher temperature than you formed the initial crystal. This new crystal has adifferent structure. What is this called when a material that has been processeddifferently has different structures? What does the fact that the different structurespreferentially form at different temperatures indicate?(F) You can engineer beams of DNA (see below) and construct structural elements,where the beams are "pre-stressed", or constructed with built in stresses. What kindof stresses do the beams experience if they have forces acting perpendicular totheir cross-sectional area?(G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams,what mechanical stress would the construct experience?(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure,and it increases in dimension in the perpendicular direction, what do you knowabout the Poisson's ratio of this material? Explain how the behavior compares witha typical material.

Hi! Since you posted many questions, we will be answering the first three for you. Please post the…

3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer?

3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer?

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter2: The Chemical Level Of Organization

Section: Chapter Questions

Problem 30RQ: In DNA, nucleotide bonding forms a compound with a characteristic shape known as a(n) ________. beta...

See similar textbooks

Similar questions

7. Hydrogen bonds are a crucial component of biomolecular structure and biomolecular interactions. In the following drawings, draw in several hydrogen bonds that are possible between atoms within the same molecule or between different molecules: A: Protein structure H₂C₁ #1 N-H N-C 0=C HR 1 N-H ORU 0=C N-HH-CR B: DNA base-pairing H H-N N-H N=C C-C H 0=C NIH C C=N HR 0=3₁ HR H-9-4 0-0 NIH N-H 0=C 0=0 RECH N-H N-H 0=8-₁ OH HR C: Plant cell wall (cellulose) CH₂OH H BỆNH O=C HA CH OH H CH₂OH ( он H HC-0 CH₂₂OH H OH 1 TH OH H IN HC- OH H CH₂OH CH₂₂OH O OH H C-CH H bH CH₂₂OH VA HS COK H ОН Biomolecules like DNA, proteins, and carbohydrates depend on hydrogen bonds to maintain their overall structure. However, each individual hydrogen bond is relatively weak. Using protein structure from the question above as an example, explain how to resolve the apparent contradiction between these two statements.
Which of the following statements is (are) true? (a) The two strands of DNA run parallel from their 5' to their 3' ends. (b) An adenine–thymine base pair contains three hydrogen bonds. (c) Positively charged counterions are associated with DNA. (d) DNA base pairs are always perpendicular to the helix axis
1. In DNA, which chemical processes result in the formation of 3'-5' phosphodiester bond and C1 sugar-base bond, respectively? Do condensation and glycosidic bond take place? 2. H bond plays vital role for the stability of protein secondary structure. Similarly, are there any specific force/bonding that is the most important for tertiary and quarternary structure, respectively? If there is, what are they?
(a) In what important ways do the α helix and β sheet structures differ? (b) How are they similar?
2. Carbohydrates have chemical bonds that are a good source of energy for living things. A monosaccharide is a carbohydrate made by plants when energy from the sun combines water and carbon dioxide. The two other types of carbohydrates formed are disaccharides and polysaccharides. Give examples of each type. a. Disaccharides: b. Polysaccharides:
b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run the same way? d. How are the chains connected? e. Which bases bond to each other? f. What kinds of bonds hold the chain together? 3. What are the main differences between RNA and DNA? 4. Distinguish between the structure of pyrimidines and purines. Explain why adenine bonds only to thymine. 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each base. Then indicate if the base if found in DNA (D), RNA (R), or both (B) hp
1. In one (1) sentence point out a key structural similarity and difference in each of the following pair of terms: a) Cellulose and chitin b) α (alpha)- and β(beta)- anomers c) glycosidic and ester bonds d) triacylglycerols and glycerophospholipids e) linoleic and linolenic acids
8. The following proteins represent a wide range of molecular weights and isoelectric points. Mr is the molecular weight of a single protein chain. • Protein 1: Mr 68,544; pl 6.11 (monomer) • Protein 2: Mr 29,041; pl 5.32 (dimer) • Protein 3: Mr 15,805; pl 5.7 (dimer) • Protein 4: Mr 12,165; pl 4.74 a. Which protein is the most acidic? Explain your answer. b. Which protein will migrate the slowest in an SDS-PAGE? Explain your answer. c. In what order will these proteins elute from a cation exchanger at pH 8? Explain your answer. d. In what order will these proteins salt out from a pH 7 solution by the dropwise addition of saturated ammonium sulfate? Explain your answer. 83°F 立

The structure shown below is a nucleic acid. (a) Decide whether it's a DNA or an RNA, and explain your answer. Clearly indicate on the diagram where you looked to decide. (b) What atom is represented by the orange sphere in the figure? (c) An arrow at the bottom right of the figure is drawn to a specific base. Is this a purine or a pyrimidine? Explain. Identify the specific base; explain.
1. a) What does DNA stand for? b)What is the name of the DNA structure?
Lamin polypeptides (nuclear lamina) form dimers in which the central α-helical regions of two polypeptide chains are wound around each other. This is called a coiled coil. a) True b) False
A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both parts