Homework Help is Here – Start Your Trial Now!
Science
Biology
3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer?

3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer?

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
PLEASE help me to respond this question, anything you can help please. I really need help
(G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material.
Transcribed Image Text:(G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material.
3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material.
Transcribed Image Text:3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Types of communication
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS