3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer?
3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer?
Anatomy & Physiology
1st Edition
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Chapter2: The Chemical Level Of Organization
Section: Chapter Questions
Problem 30RQ: In DNA, nucleotide bonding forms a compound with a characteristic shape known as a(n) ________. beta...
Related questions
Question
PLEASE help me to respond this question, anything you can help please. I really need help
![(G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams,
what mechanical stress would the construct experience?
(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure,
and it increases in dimension in the perpendicular direction, what do you know
about the Poisson's ratio of this material? Explain how the behavior compares with
a typical material.](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fdcb50413-80d6-469c-93cd-08f16902242b%2Faf469c55-3b99-4afc-8d16-d1051307b010%2Fn0orlt_processed.jpeg&w=3840&q=75)
Transcribed Image Text:(G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams,
what mechanical stress would the construct experience?
(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure,
and it increases in dimension in the perpendicular direction, what do you know
about the Poisson's ratio of this material? Explain how the behavior compares with
a typical material.
![3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we
write the chemical formula of the polymer sequence in shorthand notation, where each
monomer is represented by a letter.
Consider the DNA sequence:
ATATGACGATTGATATCCGGGATACT
(A) How many distinct types of monomer units are in this polymer?
(B) Considering the ordering of the monomers, what is this type of polymer called?
(C) We can use a sequencing machine to artificially construct any DNA sequence we
want, such as this:
AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA
What type of polymer would this be?
(D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find
that when you measure the mechanical properties along one direction of the crystal
it has a different response than along the opposite direction.
What do you call a material when the measured properties are different along different
crystal directions?
(E) You melt the DNA crystal by raising the temperature and let the crystal reform at a
higher temperature than you formed the initial crystal. This new crystal has a
different structure. What is this called when a material that has been processed
differently has different structures? What does the fact that the different structures
preferentially form at different temperatures indicate?
(F) You can engineer beams of DNA (see below) and construct structural elements,
where the beams are "pre-stressed", or constructed with built in stresses. What kind
of stresses do the beams experience if they have forces acting perpendicular to
their cross-sectional area?
(G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams,
what mechanical stress would the construct experience?
(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure,
and it increases in dimension in the perpendicular direction, what do you know
about the Poisson's ratio of this material? Explain how the behavior compares with
a typical material.](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fdcb50413-80d6-469c-93cd-08f16902242b%2Faf469c55-3b99-4afc-8d16-d1051307b010%2Fc4lh22n_processed.jpeg&w=3840&q=75)
Transcribed Image Text:3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we
write the chemical formula of the polymer sequence in shorthand notation, where each
monomer is represented by a letter.
Consider the DNA sequence:
ATATGACGATTGATATCCGGGATACT
(A) How many distinct types of monomer units are in this polymer?
(B) Considering the ordering of the monomers, what is this type of polymer called?
(C) We can use a sequencing machine to artificially construct any DNA sequence we
want, such as this:
AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA
What type of polymer would this be?
(D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find
that when you measure the mechanical properties along one direction of the crystal
it has a different response than along the opposite direction.
What do you call a material when the measured properties are different along different
crystal directions?
(E) You melt the DNA crystal by raising the temperature and let the crystal reform at a
higher temperature than you formed the initial crystal. This new crystal has a
different structure. What is this called when a material that has been processed
differently has different structures? What does the fact that the different structures
preferentially form at different temperatures indicate?
(F) You can engineer beams of DNA (see below) and construct structural elements,
where the beams are "pre-stressed", or constructed with built in stresses. What kind
of stresses do the beams experience if they have forces acting perpendicular to
their cross-sectional area?
(G)lf an enzyme that cuts DNA, binds to one of the strands connecting the beams,
what mechanical stress would the construct experience?
(H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure,
and it increases in dimension in the perpendicular direction, what do you know
about the Poisson's ratio of this material? Explain how the behavior compares with
a typical material.
Expert Solution
![](/static/compass_v2/shared-icons/check-mark.png)
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution!
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781938168130/9781938168130_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781938168130/9781938168130_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College