Q: The energy to hydrolyze (split) water comes from: A. an oxidized chlorophyll B. a reduced…
A: The splitting of water in photosynthesis is a crucial step that not only provides oxygen but also…
Q: Build four flash cards, one for Chocolate, MacConkey, TSA-blood and CNA-blood agar media. Your Mac…
A: The term "media" in the field of microbiology describes the materials or concoctions accustomed to…
Q: Examine the table of characters given for four different species of flower. Species A Species B…
A: Traits are identifiable traits or qualities of an organism that can be measured or observed, and…
Q: 1. The pH of the stomach is integral to how food digests. Explain why this is and what can happen…
A: Digestion refers to the process of mechanically and enzymatically breaking food into substances that…
Q: Propliopithecids vs. Parapithecids. Adapids and Omomyids. Dryopithecus and Oreopithecus. With the…
A: Primates are social creatures that live in various sized groups. They communicate with one another…
Q: In the figure below, F represents G F & G unite to form F and G represents LA O lateral horn;…
A: Spinal cord is divided into the regions of gray matter and white matter, gray matter is further…
Q: In the photosynthetic formation of ATP, the enzyme ATP synthase couples the synthesis of ATP to: A.…
A: Cellular respiration involves the breakdown of glucose and the production of energy in the presence…
Q: Steps Step 1 Step 2 Step 3 Step 4 Step 5 Enzyme/s involved Protein Metabolism Electron carriers ATP…
A: The many chemical processes and cellular pathways associated with the production (anabolism) and…
Q: Black fur in mice (B) is dominant to brown fur (b). Short tails (T) is dominant to long tails (t).…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…
A: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…
Q: 1)You can see something at 10x but not at 40x or 100x, what do you do? 2)Your microscope has light,…
A: Using a microscope, a scientist can examine specimens or things that are too small to be seen by the…
Q: 1. You are given 2 unlabelled beakers, one filled with a solution of salt water with 20%…
A: Osmosis is a process in which the movement of water molecules occurs from a lower solute…
Q: Q4.4. In a certain species of flowering plant, the allele for red petal color is dominant and the…
A: Genes are the hereditary units of DNA responsible for controlling a particular trait…
Q: How many clades are there in this phylogeny?
A: A phylogenetic tree is a diagram which is used to represent and study evolutionary relationships…
Q: The image shows a transverse section of an intestinal wall at 100 x magnification. Identify the…
A: The intestinal tract's small intestine comes after the stomach, which is subsequently followed by…
Q: blood type B 18₁ AB blood type A blood type AB blood type O 1^₁ 11 IB IA Genotype Phenotype Genotype…
A: The parent belonging to the blood group A has genotype IAI and the parent belonging to the blood…
Q: True or False. Explain. Nucleosomes are aided in their formation by the high proportion of…
A: The statement given relates to the formation of nucleosomes, which are crucial units of DNA…
Q: Scientists can measure evolution in both individuals and in populations. True False
A: Evolution is the net directional change or any cumulative change in the characteristics of organism…
Q: Match the term to its best definition. molecule with high-energy bond that carries amino acid to…
A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis…
Q: Calculate the fractional saturation for emperor penguin myoglobin, which has a p50 value of 2.5…
A: Fractional saturation of myoglobin refers to proportion of mygloglobin that is bound to oxygen. p50-…
Q: ribe the role that phosphorylation plays in glucose metabolism
A: Phosphorylation is the process of attaching a phosphoryl group to molecules. Dephosphorylation, or…
Q: How are tarsiers different from all other primates? How are African-Eurasian monkeys different from…
A: Primates are a group of mammals that includes humans, apes, monkeys, and lemurs. They are…
Q: jumper ant is 2n = 2. XX is 2n = 4. has one pair of homologous chromosomes. has the same number of…
A: Mitosis is a type of cell division that occurs in normal cells. This division is responsible for…
Q: Part D. Read the clues for the jumbled words that appear below. Unscramble the words and place them…
A: Photosynthesis and respiration are the major processes in nature. Photosynthesis occurs in plants…
Q: If the shown serial dilutions are performed, starting with a 5M stock of sodium acetate, what is the…
A: Serial dilution is a laboratory method used in biology to dilute a concentrated substance in a…
Q: Adherens junctions link together adjacent cells in an epithelial sheet through the lateral…
A: Adhersion junctions are mainly protein complexes that occur at cell cell junctions, also at cell…
Q: Deforestation can have many local effects. For example, is the amount of light that is reflected off…
A: Deforestation is a severe problem with numerous local implications. The loss of trees, which absorb…
Q: Below are examples of exposures. Match the examples with the type of exposure. Season __…
A: Environmental exposures include a range of factors that can have an effect on a person's health,…
Q: Part 1 ( Select the correct conversion factor needed for this calculation: Choose one: 1 mg…
A: Acetaminophen is a painkiller which is used to treat mild to moderate pain from headaches, muscle…
Q: Several hypotheses have been proposed as explanations for hominin evolution and the emergence of…
A: A terrestrial locomotion where tetrapods move by their two rear limbs or legs is known as…
Q: Describe at least one cranial and one postcranial trait that suggests Ardi was bipedal.
A: An early human species known as Ardi, or Ardipithecus ramidus, lived in Ethiopia around 4.4 million…
Q: Blood pH and cerebrospinal fluid pH are affected by carbon dioxide content. This enables the…
A: Carbon dioxide plays a significant role in regulating the pH of both blood and cerebrospinal fluid.…
Q: Which of the following is a difference between Adapoids and Omomyoids? A. Adapoids had a bony…
A: The question addresses a key differentiation between two groups of early primates, Adapoids and…
Q: QUESTION 23 Which of the following is NOT an assumption of the Hardy-Weinberg Equilibrium principle?…
A: It assumes conditions under which alleles frequency in the population remains constant.
Q: Which of the following is not part of the eukaryotic RNA processing? 5' capping initiation All are…
A: The production of RNA from DNA is known as transcription. Eukaryotic RNA undergoes massive…
Q: Describe the structure of a bacterial genome, and explain how it differs from a eukaryotic genome.
A: Bacteria are widespread, mostly free-living creatures with only one biological cell. They constitute…
Q: Primates typically have multiple offspring each year and these offspring mature very quickly and…
A: Primates have forward-facing eyes with overlapping fields of view that allow depth perception. The…
Q: 5. In the diagram, structures I and II refer respectively to the: amino and carboxyl functional…
A: Functional group:-A functional group is a particular group of atoms or a structural arrangement of…
Q: The X's correspond to the missing information. You need to determine what those X's represent DNA…
A: DNA, RNA, and protein are the three principal molecules that store and transmit genetic information…
Q: What is one anatomical difference between Australopithecines and other early hominins, such as Ardi?…
A: The answer is: B. Ardi had a divergent big toe while the Australopithecines had non-divergent big…
Q: Can Hydrophobic Interaction Bead Chromatography be used to isolate Protein X from muscle tissue if…
A: Chromatography is a vital biophysical technique for separating, identifying, and purifying the…
Q: The _____ is an area of the hypothalamus that initiates eating and controls several aspects of…
A: The brain and behavior are intricately connected and interconnected. The brain gets information and…
Q: Zone or maturation Xylem Epidermis Protoderm Phloem Root hair Procambium Endodermis Cortex Zone of…
A: This is the ultrastructure of root. Root is the lowermost part of the plant body which inserts…
Q: Our species, H. sapiens, derived from: OH. floresiensis. OH. ergaster. OH. habilis. H. rudolfensis.
A: Homo sapiens, the species to which all modern humans belong, is unique in the Homo genus. Its…
Q: Which characteristics correctly describe the cytoskeleton? provides structure for the cell structure…
A: Cytoskeleton:Intracellular network of protein filaments in the cytoplasmProtein filaments are…
Q: Interpret the following flowgram and write down its sequence 3 2 1 A T Answer: ATACGGC G C talu
A: DNA is made up of nucleotides which is its monomer. Each nucleotide is made up of phosphate group,…
Q: When DNA sequence from a diploid individaul is of a 1,0000 nucleotide region. FInd the # of…
A: To calculate the number of pairwise differences you can expect between two alleles in a diploid…
Q: Which of the following mechanisms of evolution would have the SMALLEST impact on allele frequency…
A: An allele is one of two forms of a gene. Allele frequency describes how common an allele is in a…
Q: Design an experiment that will allow to determine if there is fungal adaption to thermal soils -Draw…
A: In various ecosystems, soil temperature plays a pivotal role in shaping the composition and…
Q: During a pulse-chase experiment with secreted proteins, the proteins are synthesized for a short…
A: Pulse-chase experiment is used to study the dynamics of synthesis of proteins, maturation and…
Step by step
Solved in 3 steps
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleUsing the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.Use the codon chart to translate the following MRNA transcript into a protein. Please format your answer in this way .....*. Seond letter UUU UUC UCU UCC UCA UAU UAC U Cys Phe UGU UGC UAA Stop UGA Stop A UAG Stop UGG TrpG Tyr C Ser UUA Leu UUG UCG CUU CCU CGU CGC CAU His CUC CAC C. CỦA CUG Leu Pro Arg CCA CGA CAA CAG Gin CGG AAU AGU AGC AUU ACU Asn Ser AUC lle ACC AAC Thr AUA AUG Met ACG ACA AAA AGA A. Arg AAG Lys AGG GCU GCC GCA GUU GAU GGU GGC Asp GUC Val GUA GAC GAA GAG Ala Gly GGA GGG Glu GUG GCG AUGCCUGGACAUUUUCAAGUAUAA HTML Editor BIUA - A - I E Z I 1 I x x, E E Paragraph First letter Third letterThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY
- The following questions refer to this table of codons. Second Base U A G UUU UCU UAU UGU ] Cys Phe Tyr UUC UCC UAC UGC Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His CUC CCC CAC CGC Leu Pro Arg CUA CCA СА CGA Gin CUG CG CAG CGG AUU ACU AAU AGU Asn Ser AUC Ile ACC AAC AGC Thr AUA ACA AAA AGA Met or Start ] Lys Arg AGG AUG ACG AAG G GUU GCU GAU GGU Asp GAC GUC GCC GGC G Val Ala Gly GUA GCA GAA GGA Glu GUG GCG GAG GGG What amino acid sequence will be generated, based on the following mRNA codon sequence? 5' AUG- UCU- UCG- UUA- UCC- UUG 3' met-arg-glu-arg-glu-arg met-ser-ser-leu-ser-leu met-glu-arg-arg-glu-leu met-ser-leu-ser-leu-ser First Base Third BasemRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter