21. The two-gene model for inheritance of tan, gray, brown, and green lentil seed color ( crosses. was tested by performing additional a. Explain how self-crossing individual F₂ plants grown from seeds of each color would confirm the two-gene model. What phenotypes would be expected in the F3 seeds? Would all of the F₂ of a particular color be expected to produce the same kinds of F3? b. The cross series starting with pure-breeding tan and gray lentils in is consistent with the following dominance relations: A (tan) is completely dominant to a (green), while B (gray) is completely dominant to b (green). This idea was tested by performing all of the other possible pairwise crosses of pure-breeding lines of each color (tan x green, brown x gray, etc.). We now know that this model is correct. For each cross between pure-breeding parents, determine the expected genotypic and phenotypic ratios for the F, and F₂ generations.

Q: What are the origin, insertion, and nerve supply for Buccinator? origin: insertion: nerve supply:

A: The buccinator is a muscle that is present in the face in the cheek area. This muscle shaped as a…

Q: 152+(8.635x102 )+(0.021x103 )

A: While adding these, we have to first change all the three numbers in same form. For this, we will…

Q: What is triticale  ?

A: Hybrid plants are produced when plant breeders intentionally cross-pollinate the two different…

Q: Type of muscle: Structure B:

A: Ans. The figure represents the structure of the cardiac muscle. Muscle is an organ made up of muscle…

Q: Define Colpocystocele

A: In humans, the urinary bladder refers to the hollow muscular organ that stores the urine passed from…

Q: What is the function of contractile vacuole?

A: Vacuoles are found in animals as well as plants cell. Plant cells have a large and permanent vacuole…

Q: 31. ________________ recapitulate the processes of skeletal muscle myogenesis.     dentric cells…

A: Skeletal muscles are one of the most important types of muscles in the body, These are contractile…

Q: Expand GEAC.

A: The technology that is used for producing artificial DNA through the combination of different…

Q: 5) what causes the plateau phase during a cardiac muscle action potential? a) open voltage gated K+…

A: Heart/Cardiac muscle's main work is to generate force in order to pump blood into the bloodstream.…

Q: Exolain the benificial role of host/ the microbiota and microbiome and include factors that…

A: The microbiome consists of a community of microorganisms which include bacteria, fungi, protozoans,…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: 2. What can we do to slow the spread of antibiotic resistance?

A: One of the major risks to modern development and food security is antibiotic resistance. Everyone,…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.