Helpp 2 2. Design an algorithm to determine whether the optimal mixed alignment with globalend in both sequences A and B is unique or not.

To determine whether the optimal mixed alignment with global end in both sequences A and B is…

Answered: 2. Design an algorithm to determine…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter12: Mendel's Experiments And Heredity

Section: Chapter Questions

Problem 29CTQ: Why is it more efficient to perform a test cross with a homozygous recessive donor than a homozygous...

See similar textbooks

Similar questions

4. Allele specific oligo-nucleotide hybridization is a genetic test used to look for single nucleotide polymorphisms (SNPS) associated with genetic diseases. It uses short sequences of labeled DNA as probes to bind onto either the normal allele or mutated allele in a patient's sample. Given that hemocystinuria is an autosomal recessive disease, use the results from the ASOH test below to determine the GENOTYPE and PHENOTYPE of the newborns born at Henry Mayo Hospital this week. Luis Mina Emma Elias Genotype Phenotype Allele H probe Allele h probe Luis Mina Emma Elias
1. a. Examine the following image showing the results of an ALU insert gel-like. The first lane is the molecular marker. How many + alleles are represented in lanes 2-8? Assume each lane is an individual's amplified diploid DNA. b.The first lane is the molecular marker. How many - alleles are represented in lanes 2-8? Assume each lane is an individual's amplified diploid DNA. c.The first lane is the molecular marker. If lanes 2-8 represent the seven students in the class, what is the frequency of the + allele in this small population? d. If this gel represents the genotypes of all 7 students in a class, what is the EXPECTED number of people that would have a +/+ genotype if this small population were in Hardy-Weinberg equilibrium? (To nearest tenth)
2. You are making a genetic map and use a cross to measure the distance between genes H and J as 40cMand the distance between J and M as 20cM. When you measure the distance between genes H and M, you get 50 cM. Do the following (A-C). (A) Draw and label a map of genes H, J, and M. (B) What is the genetic distance between genes H and M? How do you know? (Answer in 1 sentence) (C) Complete the table (right). For each pair of genes, write “yes” or “no” to indicate whether the pair of genes are“linked genes” and/orpart of the same“linkage group”.
1. Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg a) What are the first eight amino acids for each of these five DNA sequences?
6. What is the most likely order of the linked genes R, S, and T if the distance between R and S is 27 m.u., the distance between S and T is 12 m.u., and the distance between R and T is 15 m.u.?
(a) Explain sensitivity and selectivity in terms of true and false positives. (b) What is the advantage of a Needleman-Wunsch alignment compared to a seeded alignment? (c) What does the expectation parameter mean in local alignment? What will happen if the expectation value is increased from its default value of 10 to a 100?
5) A maize farmer plans to plant varieties X and Y of maize each in four plots. Illustrate a randomization of the plots. S
4) The government of Iceland has built a database which contains genetic informaiton about individuals using SNP analysis and other methods, which can be used to help diagnose pre-disposition to genetic diseases and other conditions. What are some ethical issues that are raised by compiling such a database?
4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence
3. Animation 12.1: This table shows results from allele-specific oligonucleotide hybridization analyses conducted on three different patients. The analyses all used the same probes constructed to test for the presence of a mutant gene. A plus sign (+) indicates hybridization occurred and a negative sign (-) indicates no hybridization occurred. Patient #1 Patient #2 Patient #3 Probe for normal allele Probe for mutant allele Which patient(s) is/are homozygous for the mutation and which patient(s) is/are heterozygous for the mutation? O Patients #2 and #3 are homozygous and Patient #1 is heterozygous for the mutation. O Patient #2 is homozygous and Patient #1 is heterozygous for the mutation. O Patient #1 is homozygous and Patients #2 and #3 are heterozygous for the mutation. O Patient # 1 is homozygous and Patient #2 is heterozygous for the mutation.
Please asap
Recombination frequencies between four genetically-linked loci in corn are shown in the following table: Loci Recombination Frequency (%) R and Q 45 W and Q 60 R and W 15 Q and L 10 L and R 35 What is the order of the genes on the chromosome? (note: The same answer can be represented forward or backwards. e.g. A B C D = D C B A) RQWL LQWR QWLR QRLW WRLQ

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS

2. Design an algorithm to determine whether the optimal mixed alignment with global end in both sequences A and B is unique or not.